PlantPromoterDB promoter information of J075118C23

Summary of Gene (J075118C23)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0366100        NCBI 
Gene model J075118C23  
Description NONE  


Focused view (chromosome 8: 17069930-17071129)

Genome position     
from initiation codon
TSS from cDNA
TSS information
J075118C23                       5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


Promoter Summary of J075118C23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakGclone+17070284AK120339, J065045E03, J065078N12, J065170B05, J075057L17, AK120339, J013060M10, J075059F17, J065164D10, J075166J20, J065016A02, J075109J04, J100057L03, AK061882, J090052H04, J033095L23, J075039K19, J075039M06, J075120B14, J100059G23, J065041H14, J065043F09, J065075L19, J075153I11, J023135H23, J065105J19, J100051E13, J075156C19, J065162I03, J065058F23, J065010L09

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
REGGTCCCTCA+1707000817070015AK061882, AK120339, J013060M10, J023135H23, J033095L23, J065010L09, J065016A02, J065041H14, J065043F09, J065045E03, J065058F23, J065075L19, J065078N12, J065105J19, J065162I03, J065164D10, J065170B05, J075039K19, J075039M06, J075057L17, J075059F17, J075109J04, J075120B14, J075153I11, J075156C19, J075166J20, J090052H04, J100051E13, J100057L03, J100059G23
REGGGTCCCACC+1707018117070189AK061882, AK120339, J013060M10, J023135H23, J033095L23, J065010L09, J065016A02, J065041H14, J065043F09, J065045E03, J065058F23, J065075L19, J065078N12, J065105J19, J065162I03, J065164D10, J065170B05, J075039K19, J075039M06, J075057L17, J075059F17, J075109J04, J075120B14, J075153I11, J075156C19, J075166J20, J090052H04, J100051E13, J100057L03, J100059G23
REGAGGTGGGCCCCACCTGTCAG+1707020617070225AK061882, AK120339, J013060M10, J023135H23, J033095L23, J065010L09, J065016A02, J065041H14, J065043F09, J065045E03, J065058F23, J065075L19, J065078N12, J065105J19, J065162I03, J065164D10, J065170B05, J075039K19, J075039M06, J075057L17, J075059F17, J075109J04, J075120B14, J075153I11, J075156C19, J075166J20, J090052H04, J100051E13, J100057L03, J100059G23
 OsREG476AGGTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC        PPDB Motif  PLACE Motif 
 OsREG612      GCCCCACC       PPDB Motif  PLACE Motif 
 OsREG514        CCCACCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG436         CCACCTGT    PPDB Motif  PLACE Motif 
 OsREG501          CACCTGTC   PPDB Motif  PLACE Motif 
 OsREG551            CCTGTCAG PPDB Motif  PLACE MotifTGAC 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.