version
PlantPromoterDB promoter information of J075120E23

Summary of Gene (J075120E23)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0954400        NCBI 
Gene model J075120E23  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 43819859-43821058)

Genome position     
from initiation codon
003-009-F12         
012-080-B09         
AK065709            
AK104335            
J013039J02          
J033081E17          
J075058B02          
J075067K19          
J075147I16          
TSS from cDNA
TSS information
J075120E23                       5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075120E23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+43820556-303
TSS clone peakGclone+43820558-301

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTTCCTCCTCTCCTCTC+4382056643820585-293-274
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGATGGGCCAG+4382036343820373-496-486
 OsREG553CGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCTTT+4382038943820399-470-460
 OsREG437ACATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG429  ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGCGGGCCGTC+4382040843820416-451-443
 OsREG446CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG584 GGGCCGTC PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCGA+4382043143820441-428-418
 OsREG610TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.