version
PlantPromoterDB promoter information of J075125G02

Summary of Gene (J075125G02)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0633100        NCBI 
Gene model J075125G02  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 27013443-27014642)

Genome position     
from initiation codon
AK071497            
AY028314            
J023098M19          
J065140A03          
J075002A18          
J075003D18          
J075003P22          
J075007P04          
J075008H02          
J075008O09          
J075009D14          
J075013C23          
J075014O17          
J075015C06          
J075017E04          
J075017O07          
J075021H02          
J075025G20          
J075027G04          
J075035O08          
J075041F14          
J075045E23          
J075048J21          
J075048L20          
J075049M07          
J075051M12          
J075052N24          
J075053J06          
J075055D04          
J075055K03          
J075056A07          
J075058A14          
J075059K06          
J075061E18          
J075063N02          
J075068L23          
J075071D03          
J075073L08          
J075074F14          
J075074F24          
J075081O03          
J075084C14          
J075091G09          
J075093A21          
J075095N05          
J075099C15          
J075103N15          
J075108N04          
J075109D05          
J075109E10          
J075112E18          
J075114A14          
J075115H10          
J075119M22          
J075122H16          
J075125H04          
J075127N21          
J075129N05          
J075132I23          
J075135L05          
J075136K13          
J075136O20          
J075138L11          
J075144L17          
J075147C20          
J075150D05          
J075153J16          
J075156D14          
J075160D11          
J075161H09          
J075162L05          
J075165A03          
J075166G11          
J075166N20          
J075166O07          
J075169F09          
J075169H14          
J075173I07          
J075177J22          
J075179C10          
J075179N14          
J075181L14          
J075181M16          
J075187P07          
J075189G12          
J075190L05          
J090010I17          
J090011G03          
J090018C10          
J090022D16          
J090022P06          
J090034C10          
J090039K11          
J090046K13          
J090047C22          
J090049M10          
J090051C20          
J090053C08          
J090055C03          
J090061A13          
J090063I06          
J090073D22          
J090073K07          
J090079F22          
J090084D24          
J090093A06          
J090094L11          
J090099F10          
J090099M20          
U66041              
TSS from cDNA
TSS information
J075125G02                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075125G02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.