version
PlantPromoterDB promoter information of J075130D23

Summary of Gene (J075130D23)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0287200        NCBI 
Gene model J075130D23  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 10957674-10958873)

Genome position     
from initiation codon
009-067-B11         
009-130-F06         
009-185-H10         
AF338343            
AK063847            
AK121477            
J023149H05          
J065019G18          
J065049J18          
J065143C22          
J090014I22          
J090018A06          
J090053H11          
J090080N13          
J100019H19          
TSS from cDNA
TSS information
J075130D23                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075130D23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+10958602-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGCCCATTTGGGCCCAATT+1095847410958495-200-179
 OsREG615GCCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT            PPDB MotifGCCCA  PLACE Motif 
 OsREG422    GCCCATTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG493        ATTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG625         TTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639          TTGGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492             GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433              GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCAACT+1095850110958511-173-163
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479   GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACCT+1095854110958549-133-125
 OsREG462AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476 GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGCCCATCCA+1095855110958558-123-116
 OsREG534CCCATCCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.