version
PlantPromoterDB promoter information of J075138P13

Summary of Gene (J075138P13)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0563300        NCBI 
Gene model J075138P13  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 28595337-28596536)

Genome position     
from initiation codon
AK060281            
AK100487            
J023097O18          
J065100E16          
J075022C23          
J075023L18          
J075040N10          
J075061L14          
J075069B15          
J075106C16          
J075139H18          
J075139L06          
J075149B07          
J075177N21          
TSS from cDNA
TSS information
J075138P13                       5'->3' (+)
Promoter sequence












 
                    
Os04g0563200        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075138P13

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+28596124-213

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACGTGGGTCCCA+2859582628595840-511-497
 OsREG508CCCACGTGGG      PPDB MotifACGT  PLACE Motif 
 OsREG622     GTGGGTCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637      TGGGTCCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG648       GGGTCCCA PPDB MotifGGGACCC  PLACE Motif 
REGCGCCACGT+2859585328595860-484-477
 OsREG448CGCCACGT PPDB MotifACGT  PLACE MotifACGTGKC 
REGCAGGTGGGCCCGGCCCATA+2859601828596036-319-301
 OsREG514CAGGTGGG            PPDB MotifGCCCA  PLACE Motif 
 OsREG476 AGGTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG566    TGGGCCCG        PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG543     GGGCCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG616      GGCCCGGC      PPDB Motif  PLACE Motif 
 OsREG614       GCCCGGCC     PPDB Motif  PLACE Motif 
 OsREG538        CCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542         CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG490          CGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG630           GGCCCATA PPDB MotifGCCCA  PLACE Motif 
REGTGGTGGGC+2859604528596052-292-285
 OsREG599TGGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCACGC+2859607128596082-266-255
 OsREG538CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG602    GCCCACGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.