version
PlantPromoterDB promoter information of J075139C01

Summary of Gene (J075139C01)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0214300        NCBI 
Gene model J075139C01  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 6288671-6287472)

Genome position     
from initiation codon
D11431              
J065077J05          
J075001J02          
J075001J20          
J075002F04          
J075003A13          
J075003E20          
J075004E15          
J075004M03          
J075005A06          
J075005G18          
J075007F22          
J075007I09          
J075009A01          
J075009B11          
J075009D13          
J075010M04          
J075013H18          
J075017D18          
J075017F22          
J075018P10          
J075019C22          
J075023L04          
J075023P03          
J075024F07          
J075025B04          
J075025C09          
J075027I18          
J075030A10          
J075031K05          
J075033E21          
J075033K10          
J075034I15          
J075035L12          
J075037L15          
J075038E21          
J075038L11          
J075039D20          
J075039E12          
J075041E11          
J075044F17          
J075045E13          
J075045J05          
J075046A05          
J075046K03          
J075047N11          
J075047P08          
J075048F14          
J075048M18          
J075049D01          
J075049G08          
J075050J10          
J075051C15          
J075054J03          
J075054N08          
J075055B22          
J075055G05          
J075055H16          
J075057C06          
J075057H09          
J075057J16          
J075057K15          
J075057K21          
J075058E17          
J075059N03          
J075060D05          
J075061B13          
J075061I21          
J075066A16          
J075066H10          
J075067C21          
J075068D14          
J075068E11          
J075068J12          
J075070E13          
J075071O07          
J075072G23          
J075076H08          
J075078I05          
J075079H09          
J075080G03          
J075080L01          
J075082D18          
J075082M10          
J075082N07          
J075083B18          
J075083F15          
J075083H16          
J075086B07          
J075086E20          
J075086J07          
J075087J20          
J075088J06          
J075088L02          
J075088M17          
J075088O15          
J075089A13          
J075090A02          
J075093I04          
J075093O08          
J075095L03          
J075095L07          
J075096E11          
J075096E20          
J075096F12          
J075096N06          
J075097N17          
J075098J17          
J075099O19          
J075101E05          
J075101G07          
J075103G07          
J075105A20          
J075105F01          
J075106H12          
J075106I22          
J075111G04          
J075112B17          
J075112K22          
J075114I02          
J075114K13          
J075115K17          
J075116E04          
J075116O06          
J075118O18          
J075119E10          
J075119F09          
J075119I19          
J075119K12          
J075119M04          
J075120C17          
J075120D07          
J075121A20          
J075121H16          
J075122J10          
J075122N02          
J075123A08          
J075123A14          
J075123F19          
J075123K07          
J075126G07          
J075127B13          
J075127G02          
J075127P21          
J075129H16          
J075132N24          
J075132P07          
J075134E20          
J075134L09          
J075137D12          
J075138D03          
J075138M17          
J075138N12          
J075138O22          
J075140A20          
J075142C21          
J075142E11          
J075142E21          
J075142F22          
J075143I16          
J075143J15          
J075144K03          
J075145K02          
J075146I04          
J075147B19          
J075147M06          
J075150D06          
J075150H18          
J075150O15          
J075151J11          
J075151O06          
J075156L21          
J075159B14          
J075164H12          
J075166E09          
J075167E02          
J075167E04          
J075167G22          
J075167J09          
J075169E10          
J075172E08          
J075172K11          
J075173O18          
J075174B22          
J075175A06          
J075176A04          
J075176A07          
J075176D24          
J075177L18          
J075178C04          
J075179F10          
J075179N06          
J075180D03          
J075180H07          
J075181A04          
J075181E23          
J075182O06          
J075183H17          
J075184D19          
J075185G10          
J075185L20          
J075185O14          
J075187O20          
J075187O22          
J075188C12          
J075188I11          
J075188L08          
J075190K03          
J075192D07          
J075193F02          
J075196B03          
J075196C19          
J075197E06          
J075197E24          
J075197J12          
J075199O04          
X66257              
TSS from cDNA
TSS information
J075139C01                       5'->3' (-)
Promoter sequence







 
                    
Os07g0214200        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075139C01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-6287707-36

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAGCTATATATAAAAC-62877356287749-64-78
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.