version
PlantPromoterDB promoter information of J075139O21

Summary of Gene (J075139O21)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0206500        NCBI 
Gene model J075139O21  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 5773059-5774258)

Genome position     
from initiation codon
AB016503            
J065026L09          
J065043L20          
J065046A08          
J065191B13          
J065199C04          
J075001B09          
J075001F18          
J075001H12          
J075002D19          
J075002F19          
J075002J08          
J075002K02          
J075002M04          
J075002M10          
J075003A21          
J075003D10          
J075003E15          
J075003E19          
J075003F02          
J075003K11          
J075003L11          
J075004C08          
J075004E04          
J075004F12          
J075004H19          
J075004I03          
J075005C16          
J075005F10          
J075005J19          
J075006F10          
J075006I11          
J075006I20          
J075006J02          
J075006L23          
J075006N23          
J075007B14          
J075007C05          
J075007D19          
J075007G10          
J075007H04          
J075007H11          
J075007K20          
J075007M04          
J075007N01          
J075007N07          
J075007N11          
J075007N17          
J075007N18          
J075007O07          
J075007O15          
J075008D05          
J075008G06          
J075008K17          
J075008L04          
J075008N22          
J075008O20          
J075009A17          
J075009H12          
J075009H17          
J075009K24          
J075009L22          
J075009M05          
J075009O08          
J075010C16          
J075010D02          
J075010K21          
J075010K22          
J075010L08          
J075010L24          
J075010N21          
J075010O09          
J075010P11          
J075010P12          
J075011B05          
J075011D06          
J075011J18          
J075012A03          
J075012C02          
J075012I22          
J075012J19          
J075012L13          
J075012M24          
J075013B21          
J075013E12          
J075013H01          
J075013H10          
J075013I06          
J075013L09          
J075013M16          
J075013M17          
J075013P09          
J075014A08          
J075014E03          
J075014H11          
J075014L11          
J075014O22          
J075014P20          
J075015B10          
J075015D21          
J075015G11          
J075015H13          
J075015H17          
J075015I11          
J075015J18          
J075015L24          
J075015P11          
J075016A11          
J075016A18          
J075016B01          
J075016B09          
J075016F21          
J075016I06          
J075016L16          
J075016M24          
J075017B01          
J075017B18          
J075017C14          
J075017H03          
J075017H13          
J075017I12          
J075017K10          
J075017L24          
J075017M04          
J075017N03          
J075019C09          
J075019J20          
J075019L19          
J075019P20          
J075020A01          
J075020C16          
J075020H23          
J075020L24          
J075021C11          
J075021F02          
J075021F16          
J075021I01          
J075021I19          
J075021J09          
J075021K11          
J075021M05          
J075021M17          
J075021P06          
J075022H01          
J075022K22          
J075023C09          
J075023D11          
J075023G03          
J075023G14          
J075023H19          
J075023I17          
J075023M02          
J075023N05          
J075023N11          
J075023N16          
J075023O22          
J075024C24          
J075024D05          
J075024E01          
J075024F10          
J075024I02          
J075024J08          
J075024K01          
J075025D07          
J075025G10          
J075025H18          
J075025J16          
J075025L03          
J075025P13          
J075026D14          
J075026D21          
J075026E21          
J075026F23          
J075026K08          
J075026N18          
J075026O22          
J075027C07          
J075027F19          
J075027G07          
J075027H08          
J075027I11          
J075027L02          
J075027P10          
J075028A18          
J075028C01          
J075028F14          
J075028G04          
J075028H06          
J075028I21          
J075028L20          
J075028L23          
J075028N18          
J075028O10          
J075028O18          
J075028P09          
J075029A14          
J075029J04          
J075029M14          
J075029P13          
J075030A15          
J075030B06          
J075030D05          
J075030D23          
J075030G21          
J075030J18          
J075030L07          
J075030M16          
J075030N18          
J075030N19          
J075031D14          
J075031I04          
J075031M12          
J075031O19          
J075032C16          
J075032E06          
J075032G18          
J075032I20          
J075032K11          
J075032K19          
J075032N08          
J075033B17          
J075033B19          
J075033D24          
J075033H17          
J075033L07          
J075033L11          
J075033L19          
J075033P20          
J075034A07          
J075034C14          
J075034E15          
J075034F10          
J075034I22          
J075034J12          
J075034J19          
J075034K21          
J075034O04          
J075034O12          
J075035B05          
J075035B06          
J075035D14          
J075035E16          
J075035L10          
J075035M05          
J075035M12          
J075036F22          
J075036K04          
J075036K17          
J075036P12          
J075037F03          
J075037G19          
J075037H15          
J075037L23          
J075037M17          
J075037O08          
J075038E13          
J075038G15          
J075038J15          
J075038N24          
J075038O09          
J075039F24          
J075039O16          
J075039O17          
J075040D08          
J075040D23          
J075040H18          
J075040I07          
J075040L03          
J075040N15          
J075040N18          
J075041A11          
J075041B17          
J075041G03          
J075041M13          
J075041M24          
J075041N22          
J075042A04          
J075042C05          
J075042C20          
J075042D03          
J075042E01          
J075042E07          
J075042G10          
J075042I24          
J075042M05          
J075043D12          
J075043M20          
J075044A10          
J075044B12          
J075044C20          
J075044G17          
J075044H22          
J075044M22          
J075044P19          
J075044P22          
J075045B16          
J075045C20          
J075045D05          
J075045E12          
J075045E17          
J075045N03          
J075045N09          
J075046F16          
J075046G03          
J075046K14          
J075046K15          
J075046K18          
J075046N21          
J075047B02          
J075047D15          
J075047F13          
J075047I12          
J075048B22          
J075048E10          
J075048F12          
J075048K08          
J075048N10          
J075048N18          
J075048O15          
J075049F16          
J075049J05          
J075049O14          
J075049P17          
J075050A11          
J075050A18          
J075050E21          
J075050H07          
J075050I21          
J075050K05          
J075050K12          
J075050K16          
J075050N22          
J075050P16          
J075051C01          
J075051D08          
J075051F09          
J075051G05          
J075051G22          
J075051H13          
J075051L13          
J075051M11          
J075051N12          
J075052F02          
J075052G22          
J075052H10          
J075052H16          
J075052J18          
J075052N06          
J075052P14          
J075053C15          
J075053L06          
J075053N12          
J075054C04          
J075054D17          
J075054F06          
J075054G08          
J075054G15          
J075054H21          
J075054I07          
J075054J10          
J075054L06          
J075054L17          
J075054N04          
J075055D08          
J075055I19          
J075055J05          
J075055N13          
J075056C20          
J075056F20          
J075056I19          
J075056K18          
J075056L07          
J075056O03          
J075057J08          
J075057M13          
J075057N19          
J075058B21          
J075058C06          
J075058I17          
J075058J02          
J075058L10          
J075058N02          
J075058N10          
J075058N16          
J075058O13          
J075059B11          
J075059E18          
J075059G22          
J075059H11          
J075059I02          
J075059M19          
J075060B04          
J075060D07          
J075060D18          
J075060E04          
J075060E10          
J075060G06          
J075060J22          
J075060K08          
J075060K12          
J075060K18          
J075060L24          
J075060M17          
J075060P10          
J075061B09          
J075061G02          
J075061H23          
J075061J20          
J075061K22          
J075061M05          
J075062C22          
J075062G20          
J075062H19          
J075062K04          
J075062N17          
J075063A14          
J075063E03          
J075063E06          
J075063G23          
J075064C21          
J075064H04          
J075064L04          
J075064L09          
J075065B09          
J075065F05          
J075065F19          
J075065F22          
J075065G02          
J075065L14          
J075065M19          
J075065N07          
J075066E20          
J075066E21          
J075066J04          
J075066M07          
J075066N10          
J075066N14          
J075067A04          
J075067G23          
J075067K13          
J075067L11          
J075068H01          
J075068J20          
J075068K05          
J075069B13          
J075069I24          
J075069J22          
J075069K08          
J075069K09          
J075069L16          
J075070D12          
J075070F19          
J075070I17          
J075070K14          
J075070L21          
J075070N24          
J075070P03          
J075071C23          
J075071K18          
J075071L02          
J075072B21          
J075072C17          
J075072D08          
J075072G21          
J075072I16          
J075072L08          
J075072N12          
J075073C04          
J075073C21          
J075073E13          
J075073E21          
J075073K12          
J075073P03          
J075073P04          
J075073P05          
J075074A08          
J075074B04          
J075074B09          
J075074H24          
J075074I04          
J075074K11          
J075074L03          
J075074L16          
J075074O14          
J075075A01          
J075075A07          
J075075B06          
J075075D21          
J075075H22          
J075075K07          
J075075L03          
J075075M20          
J075075O15          
J075075P07          
J075076A18          
J075076F10          
J075076G21          
J075076H03          
J075076M04          
J075076O07          
J075076P06          
J075077B03          
J075077C17          
J075077D14          
J075077L18          
J075078A09          
J075078B22          
J075078K22          
J075078M23          
J075078N02          
J075079B09          
J075079B10          
J075079B13          
J075079F18          
J075079G15          
J075079L08          
J075079N06          
J075079P08          
J075080E14          
J075080J12          
J075080L08          
J075081A04          
J075081C12          
J075081D08          
J075081G24          
J075081H09          
J075081I06          
J075081I19          
J075081K04          
J075081K11          
J075081M14          
J075081N08          
J075082A03          
J075082B02          
J075082G20          
J075082J05          
J075082L18          
J075083B13          
J075083H05          
J075083H17          
J075083I08          
J075083I22          
J075083N17          
J075084D17          
J075084H21          
J075084P20          
J075085A05          
J075085C22          
J075085J04          
J075085K17          
J075085M07          
J075086A09          
J075086A22          
J075086B16          
J075086B19          
J075086C13          
J075086F15          
J075086G14          
J075086I20          
J075086J02          
J075086M20          
J075086N07          
J075086N09          
J075087A09          
J075087D07          
J075087F12          
J075087H07          
J075087J10          
J075087K16          
J075087L10          
J075087P19          
J075088A11          
J075088C21          
J075088D05          
J075088I05          
J075088K13          
J075088M18          
J075088O11          
J075088O20          
J075088P09          
J075089G21          
J075089I12          
J075089O20          
J075089P18          
J075090D07          
J075090G23          
J075090H02          
J075090H07          
J075090K04          
J075091E06          
J075091F04          
J075091F10          
J075091H14          
J075091H22          
J075091J21          
J075091L08          
J075091N21          
J075091O04          
J075091O20          
J075091P03          
J075092F15          
J075092H04          
J075092I21          
J075092J16          
J075092J21          
J075092L17          
J075092L24          
J075092O18          
J075093C23          
J075093D02          
J075093E15          
J075093F01          
J075093I24          
J075093L24          
J075093M04          
J075094A04          
J075094C23          
J075094I03          
J075094K07          
J075094P06          
J075095H19          
J075095L11          
J075095N07          
J075096B12          
J075096D21          
J075096N13          
J075097A08          
J075097C09          
J075097E14          
J075097G15          
J075097G19          
J075097H05          
J075097I07          
J075097K17          
J075097L13          
J075097N11          
J075098D18          
J075098F08          
J075098F14          
J075098M09          
J075098O17          
J075099B16          
J075099E14          
J075099K08          
J075099N03          
J075099O06          
J075100C01          
J075100F15          
J075100F17          
J075100N15          
J075101B19          
J075101C10          
J075101D02          
J075101D21          
J075101F09          
J075101G11          
J075101N14          
J075102E20          
J075102E22          
J075102G11          
J075102M11          
J075102P08          
J075102P16          
J075103B20          
J075103C19          
J075103E12          
J075103K03          
J075104D07          
J075104D23          
J075104F03          
J075104F08          
J075104K06          
J075104K11          
J075104K18          
J075104N01          
J075104N13          
J075104O19          
J075105B16          
J075105C24          
J075105D03          
J075105H18          
J075105I17          
J075105J24          
J075105K17          
J075105M18          
J075105O11          
J075105P18          
J075106B21          
J075106D14          
J075106F22          
J075106M02          
J075107F05          
J075107H17          
J075108B14          
J075108C06          
J075108K13          
J075108L22          
J075108O16          
J075109B03          
J075109C19          
J075110C03          
J075110C05          
J075110D24          
J075110G17          
J075110J23          
J075110K18          
J075110P03          
J075111B22          
J075111C16          
J075111E09          
J075111F21          
J075111G13          
J075111I07          
J075111O14          
J075112A21          
J075112N01          
J075112N12          
J075114B01          
J075114C03          
J075114F10          
J075114K23          
J075114N15          
J075114N16          
J075115G17          
J075115K22          
J075116C09          
J075116C24          
J075116F03          
J075116H08          
J075116J03          
J075116K19          
J075116L05          
J075116L17          
J075116O17          
J075117F22          
J075117K05          
J075117L05          
J075117N08          
J075117N11          
J075117P18          
J075118B02          
J075118C17          
J075118D10          
J075118D24          
J075118E16          
J075118H14          
J075118I20          
J075118L14          
J075118L23          
J075118M04          
J075118O17          
J075119A01          
J075119A03          
J075119A05          
J075119A17          
J075119B05          
J075119C19          
J075119D04          
J075119D09          
J075119G01          
J075119H22          
J075119J21          
J075119L06          
J075119O09          
J075119P04          
J075119P16          
J075119P20          
J075120B03          
J075120F08          
J075120F14          
J075120M03          
J075120N02          
J075120N23          
J075120O19          
J075121I24          
J075121J23          
J075121L20          
J075121N02          
J075121P09          
J075122D20          
J075122G16          
J075122G18          
J075122J22          
J075122L22          
J075122M19          
J075122O11          
J075123D10          
J075123J15          
J075123J20          
J075123L15          
J075123M22          
J075123P22          
J075124C01          
J075124D02          
J075124D21          
J075124E24          
J075124H13          
J075124I04          
J075124I16          
J075124J20          
J075124K13          
J075124M02          
J075124M07          
J075124N23          
J075125A13          
J075125B13          
J075125C06          
J075125C17          
J075125D14          
J075125E06          
J075125H12          
J075125I07          
J075125J01          
J075125M24          
J075125P05          
J075126B03          
J075126F12          
J075126F14          
J075126H06          
J075126K16          
J075126M15          
J075126N03          
J075126N07          
J075126O13          
J075127E01          
J075127E17          
J075127H07          
J075127L02          
J075127L09          
J075128G12          
J075128H19          
J075128J16          
J075128M07          
J075128M19          
J075129C05          
J075129J03          
J075129J21          
J075129L18          
J075129M10          
J075130A08          
J075130B14          
J075130D05          
J075130E19          
J075130P14          
J075131D10          
J075131F19          
J075131L04          
J075131P17          
J075132H07          
J075132H21          
J075132K03          
J075132K18          
J075132O05          
J075133A19          
J075133D03          
J075133E03          
J075133E23          
J075133M18          
J075133O20          
J075134C02          
J075134C18          
J075134F06          
J075134F16          
J075134K01          
J075134K16          
J075134M05          
J075134P15          
J075135B13          
J075135H10          
J075136B06          
J075136F22          
J075136H21          
J075136K21          
J075136L06          
J075137A10          
J075137I12          
J075137P03          
J075137P12          
J075137P13          
J075138A10          
J075138C05          
J075138C21          
J075138J12          
J075138K09          
J075138K23          
J075138L02          
J075138P22          
J075139B21          
J075139I24          
J075140C19          
J075140E05          
J075140F12          
J075140I18          
J075140J21          
J075141B12          
J075141D10          
J075141E21          
J075141F03          
J075141H05          
J075141H23          
J075141P19          
J075142B04          
J075142B17          
J075142F03          
J075142G15          
J075142H13          
J075142J03          
J075142L11          
J075142L13          
J075142L15          
J075142M06          
J075142O04          
J075142O15          
J075143A21          
J075143B01          
J075143B10          
J075143C07          
J075143C15          
J075143D03          
J075143D20          
J075143D23          
J075143F09          
J075143G02          
J075143I24          
J075143L05          
J075143M05          
J075143N01          
J075144B08          
J075144C04          
J075144F16          
J075144I04          
J075144J22          
J075145A05          
J075145B05          
J075145D07          
J075145D13          
J075145G18          
J075145H09          
J075145I12          
J075145L03          
J075145L08          
J075145L22          
J075145M11          
J075146D05          
J075146D16          
J075146F10          
J075146G13          
J075146H01          
J075147A16          
J075147B22          
J075147E05          
J075147J02          
J075148E12          
J075148F11          
J075148J04          
J075148M11          
J075148M16          
J075148P17          
J075150B08          
J075150C12          
J075150J08          
J075150M18          
J075150N08          
J075150N12          
J075150N14          
J075151H08          
J075151I04          
J075151M12          
J075151N18          
J075151O19          
J075152A02          
J075152C03          
J075152D02          
J075152E05          
J075152E06          
J075152F09          
J075152G16          
J075152I02          
J075152I10          
J075152N06          
J075153B13          
J075153C10          
J075153E04          
J075153L19          
J075153L24          
J075153N02          
J075154A06          
J075154D07          
J075154F24          
J075154H17          
J075155A08          
J075155A14          
J075155F16          
J075155F18          
J075155K18          
J075155L23          
J075155M21          
J075155P05          
J075156D18          
J075156M05          
J075156N18          
J075157A06          
J075157C14          
J075157L11          
J075157O08          
J075158B01          
J075158B19          
J075158B20          
J075158D11          
J075158J17          
J075158L03          
J075158N07          
J075159A08          
J075159D22          
J075159G14          
J075159H16          
J075159K10          
J075160E14          
J075160E18          
J075160F14          
J075160J21          
J075160M19          
J075161B04          
J075161F23          
J075161I22          
J075161K17          
J075161M04          
J075162H19          
J075162I21          
J075162J08          
J075162K18          
J075162M19          
J075163B19          
J075163D03          
J075163G23          
J075163N14          
J075163P19          
J075164C06          
J075164C10          
J075164G24          
J075164H05          
J075164I07          
J075164J09          
J075164J16          
J075164O09          
J075165B18          
J075165D09          
J075165E24          
J075165G21          
J075165J11          
J075165K16          
J075165M03          
J075165P21          
J075166B19          
J075166C05          
J075166D01          
J075166E03          
J075166M06          
J075166P13          
J075167B19          
J075167C16          
J075167F06          
J075167F08          
J075167G23          
J075167K16          
J075167L13          
J075167P05          
J075168A17          
J075168N08          
J075168P09          
J075168P13          
J075169D18          
J075169G07          
J075170A12          
J075170I05          
J075170K19          
J075170L23          
J075170N09          
J075171A02          
J075171J11          
J075171J16          
J075171M16          
J075171N16          
J075172A22          
J075172B04          
J075172D20          
J075172H21          
J075172I19          
J075172M07          
J075172N04          
J075172N13          
J075172O15          
J075173A03          
J075173C12          
J075173D22          
J075173G10          
J075173I19          
J075174A21          
J075174B11          
J075174F03          
J075174G13          
J075174H07          
J075175A22          
J075175C03          
J075175H10          
J075175H17          
J075175J21          
J075175N10          
J075175P20          
J075176A03          
J075176B07          
J075176D16          
J075176E09          
J075176F14          
J075176G18          
J075176I24          
J075176K05          
J075176L14          
J075176O12          
J075176O15          
J075177C06          
J075177F20          
J075177I01          
J075178B02          
J075178D03          
J075178F16          
J075178G01          
J075178L09          
J075178N21          
J075179A19          
J075179F02          
J075179G19          
J075179J17          
J075180B19          
J075180C20          
J075180D21          
J075180M02          
J075181B09          
J075181C03          
J075181C17          
J075181D22          
J075181I01          
J075181I07          
J075181K20          
J075181L15          
J075181L24          
J075181M13          
J075181P14          
J075182B02          
J075182P16          
J075183E19          
J075183K22          
J075184B06          
J075184D11          
J075184F24          
J075184H23          
J075184J01          
J075184K19          
J075184L18          
J075185C22          
J075185D19          
J075185E19          
J075185G01          
J075186A16          
J075186E05          
J075186F10          
J075186F14          
J075186F24          
J075186K24          
J075186L10          
J075186O21          
J075187C22          
J075187E12          
J075187F03          
J075187K23          
J075187L01          
J075187N11          
J075187N19          
J075188B08          
J075188B09          
J075188B19          
J075188C13          
J075188F10          
J075188I09          
J075188P03          
J075188P09          
J075189F03          
J075189F23          
J075189I20          
J075189K03          
J075189N17          
J075190B16          
J075190J07          
J075190J16          
J075190J23          
J075190M02          
J075190N23          
J075191A16          
J075191C07          
J075191F03          
J075191I20          
J075191I21          
J075191K07          
J075191M24          
J075191N20          
J075191O13          
J075191P11          
J075191P13          
J075192A10          
J075192C14          
J075192D16          
J075192E03          
J075192E21          
J075192H04          
J075192L03          
J075192O07          
J075193A22          
J075193D19          
J075193F20          
J075193P17          
J075194N22          
J075195F05          
J075195F22          
J075195I04          
J075195L17          
J075195O15          
J075196C15          
J075196D21          
J075196E22          
J075196H08          
J075196I03          
J075196I08          
J075196L17          
J075196N03          
J075196O14          
J075196O15          
J075197A09          
J075197F19          
J075197P10          
J075198I21          
J075198J11          
J075199H07          
J075199H18          
J075199M21          
J075199P15          
J090017A04          
J090066L20          
X60979              
TSS from cDNA
TSS information
J075139O21                       5'->3' (+)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075139O21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+5774003-56

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATAAATA+57739685773977-91-82
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGATGGGC+57738245773831-235-228
 OsREG607TGATGGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.