version
PlantPromoterDB promoter information of J075140L01

Summary of Gene (J075140L01)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0206500        NCBI 
Gene model J075140L01  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 5772789-5773988)

Genome position     
from initiation codon
J075014L11          
J075014P20          
J075024D05          
J075025H18          
J075038J15          
J075058N16          
J075066M07          
J075079N06          
J075081H09          
J075082G20          
J075082L18          
J075089I12          
J075091O20          
J075097I07          
J075143B01          
J075143D23          
J075175A22          
J075184L18          
J075196L17          
TSS from cDNA
TSS information
J075140L01                       5'->3' (+)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075140L01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+5769029-60
TSS clone peakAclone+5769032-57

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATAAATA+57689975769006-92-83
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATAAATA+57739685773977AB016503, J065026L09, J065043L20, J065046A08, J065191B13, J065199C04, J075001B09, J075001F18, J075001H12, J075002D19, J075002F19, J075002J08, J075002K02, J075002M04, J075002M10, J075003A21, J075003D10, J075003E15, J075003E19, J075003F02, J075003K11, J075003L11, J075004C08, J075004E04, J075004F12, J075004H19, J075004I03, J075005C16, J075005F10, J075005J19, J075006F10, J075006I11, J075006I20, J075006J02, J075006L23, J075006N23, J075007B14, J075007C05, J075007D19, J075007G10, J075007H04, J075007H11, J075007K20, J075007M04, J075007N01, J075007N07, J075007N11, J075007N17, J075007N18, J075007O07, J075007O15, J075008D05, J075008G06, J075008K17, J075008L04, J075008N22, J075008O20, J075009A17, J075009H12, J075009H17, J075009K24, J075009L22, J075009M05, J075009O08, J075010C16, J075010D02, J075010K21, J075010K22, J075010L08, J075010L24, J075010N21, J075010O09, J075010P11, J075010P12, J075011B05, J075011D06, J075011J18, J075012A03, J075012C02, J075012I22, J075012J19, J075012L13, J075012M24, J075013B21, J075013E12, J075013H01, J075013H10, J075013I06, J075013L09, J075013M16, J075013M17, J075013P09, J075014A08, J075014E03, J075014H11, J075014O22, J075015B10, J075015D21, J075015G11, J075015H13, J075015H17, J075015I11, J075015J18, J075015L24, J075015P11, J075016A11, J075016A18, J075016B01, J075016B09, J075016F21, J075016I06, J075016L16, J075016M24, J075017B01, J075017B18, J075017C14, J075017H03, J075017H13, J075017I12, J075017K10, J075017L24, J075017M04, J075017N03, J075019C09, J075019J20, J075019L19, J075019P20, J075020A01, J075020C16, J075020H23, J075020L24, J075021C11, J075021F02, J075021F16, J075021I01, J075021I19, J075021J09, J075021K11, J075021M05, J075021M17, J075021P06, J075022H01, J075022K22, J075023C09, J075023D11, J075023G03, J075023G14, J075023H19, J075023I17, J075023M02, J075023N05, J075023N11, J075023N16, J075023O22, J075024C24, J075024E01, J075024F10, J075024I02, J075024J08, J075024K01, J075025D07, J075025G10, J075025J16, J075025L03, J075025P13, J075026D14, J075026D21, J075026E21, J075026F23, J075026K08, J075026N18, J075026O22, J075027C07, J075027F19, J075027G07, J075027H08, J075027I11, J075027L02, J075027P10, J075028A18, J075028C01, J075028F14, J075028G04, J075028H06, J075028I21, J075028L20, J075028L23, J075028N18, J075028O10, J075028O18, J075028P09, J075029A14, J075029J04, J075029M14, J075029P13, J075030A15, J075030B06, J075030D05, J075030D23, J075030G21, J075030J18, J075030L07, J075030M16, J075030N18, J075030N19, J075031D14, J075031I04, J075031M12, J075031O19, J075032C16, J075032E06, J075032G18, J075032I20, J075032K11, J075032K19, J075032N08, J075033B17, J075033B19, J075033D24, J075033H17, J075033L07, J075033L11, J075033L19, J075033P20, J075034A07, J075034C14, J075034E15, J075034F10, J075034I22, J075034J12, J075034J19, J075034K21, J075034O04, J075034O12, J075035B05, J075035B06, J075035D14, J075035E16, J075035L10, J075035M05, J075035M12, J075036F22, J075036K04, J075036K17, J075036P12, J075037F03, J075037G19, J075037H15, J075037L23, J075037M17, J075037O08, J075038E13, J075038G15, J075038N24, J075038O09, J075039F24, J075039O16, J075039O17, J075040D08, J075040D23, J075040H18, J075040I07, J075040L03, J075040N15, J075040N18, J075041A11, J075041B17, J075041G03, J075041M13, J075041M24, J075041N22, J075042A04, J075042C05, J075042C20, J075042D03, J075042E01, J075042E07, J075042G10, J075042I24, J075042M05, J075043D12, J075043M20, J075044A10, J075044B12, J075044C20, J075044G17, J075044H22, J075044M22, J075044P19, J075044P22, J075045B16, J075045C20, J075045D05, J075045E12, J075045E17, J075045N03, J075045N09, J075046F16, J075046G03, J075046K14, J075046K15, J075046K18, J075046N21, J075047B02, J075047D15, J075047F13, J075047I12, J075048B22, J075048E10, J075048F12, J075048K08, J075048N10, J075048N18, J075048O15, J075049F16, J075049J05, J075049O14, J075049P17, J075050A11, J075050A18, J075050E21, J075050H07, J075050I21, J075050K05, J075050K12, J075050K16, J075050N22, J075050P16, J075051C01, J075051D08, J075051F09, J075051G05, J075051G22, J075051H13, J075051L13, J075051M11, J075051N12, J075052F02, J075052G22, J075052H10, J075052H16, J075052J18, J075052N06, J075052P14, J075053C15, J075053L06, J075053N12, J075054C04, J075054D17, J075054F06, J075054G08, J075054G15, J075054H21, J075054I07, J075054J10, J075054L06, J075054L17, J075054N04, J075055D08, J075055I19, J075055J05, J075055N13, J075056C20, J075056F20, J075056I19, J075056K18, J075056L07, J075056O03, J075057J08, J075057M13, J075057N19, J075058B21, J075058C06, J075058I17, J075058J02, J075058L10, J075058N02, J075058N10, J075058O13, J075059B11, J075059E18, J075059G22, J075059H11, J075059I02, J075059M19, J075060B04, J075060D07, J075060D18, J075060E04, J075060E10, J075060G06, J075060J22, J075060K08, J075060K12, J075060K18, J075060L24, J075060M17, J075060P10, J075061B09, J075061G02, J075061H23, J075061J20, J075061K22, J075061M05, J075062C22, J075062G20, J075062H19, J075062K04, J075062N17, J075063A14, J075063E03, J075063E06, J075063G23, J075064C21, J075064H04, J075064L04, J075064L09, J075065B09, J075065F05, J075065F19, J075065F22, J075065G02, J075065L14, J075065M19, J075065N07, J075066E20, J075066E21, J075066J04, J075066N10, J075066N14, J075067A04, J075067G23, J075067K13, J075067L11, J075068H01, J075068J20, J075068K05, J075069B13, J075069I24, J075069J22, J075069K08, J075069K09, J075069L16, J075070D12, J075070F19, J075070I17, J075070K14, J075070L21, J075070N24, J075070P03, J075071C23, J075071K18, J075071L02, J075072B21, J075072C17, J075072D08, J075072G21, J075072I16, J075072L08, J075072N12, J075073C04, J075073C21, J075073E13, J075073E21, J075073K12, J075073P03, J075073P04, J075073P05, J075074A08, J075074B04, J075074B09, J075074H24, J075074I04, J075074K11, J075074L03, J075074L16, J075074O14, J075075A01, J075075A07, J075075B06, J075075D21, J075075H22, J075075K07, J075075L03, J075075M20, J075075O15, J075075P07, J075076A18, J075076F10, J075076G21, J075076H03, J075076M04, J075076O07, J075076P06, J075077B03, J075077C17, J075077D14, J075077L18, J075078A09, J075078B22, J075078K22, J075078M23, J075078N02, J075079B09, J075079B10, J075079B13, J075079F18, J075079G15, J075079L08, J075079P08, J075080E14, J075080J12, J075080L08, J075081A04, J075081C12, J075081D08, J075081G24, J075081I06, J075081I19, J075081K04, J075081K11, J075081M14, J075081N08, J075082A03, J075082B02, J075082J05, J075083B13, J075083H05, J075083H17, J075083I08, J075083I22, J075083N17, J075084D17, J075084H21, J075084P20, J075085A05, J075085C22, J075085J04, J075085K17, J075085M07, J075086A09, J075086A22, J075086B16, J075086B19, J075086C13, J075086F15, J075086G14, J075086I20, J075086J02, J075086M20, J075086N07, J075086N09, J075087A09, J075087D07, J075087F12, J075087H07, J075087J10, J075087K16, J075087L10, J075087P19, J075088A11, J075088C21, J075088D05, J075088I05, J075088K13, J075088M18, J075088O11, J075088O20, J075088P09, J075089G21, J075089O20, J075089P18, J075090D07, J075090G23, J075090H02, J075090H07, J075090K04, J075091E06, J075091F04, J075091F10, J075091H14, J075091H22, J075091J21, J075091L08, J075091N21, J075091O04, J075091P03, J075092F15, J075092H04, J075092I21, J075092J16, J075092J21, J075092L17, J075092L24, J075092O18, J075093C23, J075093D02, J075093E15, J075093F01, J075093I24, J075093L24, J075093M04, J075094A04, J075094C23, J075094I03, J075094K07, J075094P06, J075095H19, J075095L11, J075095N07, J075096B12, J075096D21, J075096N13, J075097A08, J075097C09, J075097E14, J075097G15, J075097G19, J075097H05, J075097K17, J075097L13, J075097N11, J075098D18, J075098F08, J075098F14, J075098M09, J075098O17, J075099B16, J075099E14, J075099K08, J075099N03, J075099O06, J075100C01, J075100F15, J075100F17, J075100N15, J075101B19, J075101C10, J075101D02, J075101D21, J075101F09, J075101G11, J075101N14, J075102E20, J075102E22, J075102G11, J075102M11, J075102P08, J075102P16, J075103B20, J075103C19, J075103E12, J075103K03, J075104D07, J075104D23, J075104F03, J075104F08, J075104K06, J075104K11, J075104K18, J075104N01, J075104N13, J075104O19, J075105B16, J075105C24, J075105D03, J075105H18, J075105I17, J075105J24, J075105K17, J075105M18, J075105O11, J075105P18, J075106B21, J075106D14, J075106F22, J075106M02, J075107F05, J075107H17, J075108B14, J075108C06, J075108K13, J075108L22, J075108O16, J075109B03, J075109C19, J075110C03, J075110C05, J075110D24, J075110G17, J075110J23, J075110K18, J075110P03, J075111B22, J075111C16, J075111E09, J075111F21, J075111G13, J075111I07, J075111O14, J075112A21, J075112N01, J075112N12, J075114B01, J075114C03, J075114F10, J075114K23, J075114N15, J075114N16, J075115G17, J075115K22, J075116C09, J075116C24, J075116F03, J075116H08, J075116J03, J075116K19, J075116L05, J075116L17, J075116O17, J075117F22, J075117K05, J075117L05, J075117N08, J075117N11, J075117P18, J075118B02, J075118C17, J075118D10, J075118D24, J075118E16, J075118H14, J075118I20, J075118L14, J075118L23, J075118M04, J075118O17, J075119A01, J075119A03, J075119A05, J075119A17, J075119B05, J075119C19, J075119D04, J075119D09, J075119G01, J075119H22, J075119J21, J075119L06, J075119O09, J075119P04, J075119P16, J075119P20, J075120B03, J075120F08, J075120F14, J075120M03, J075120N02, J075120N23, J075120O19, J075121I24, J075121J23, J075121L20, J075121N02, J075121P09, J075122D20, J075122G16, J075122G18, J075122J22, J075122L22, J075122M19, J075122O11, J075123D10, J075123J15, J075123J20, J075123L15, J075123M22, J075123P22, J075124C01, J075124D02, J075124D21, J075124E24, J075124H13, J075124I04, J075124I16, J075124J20, J075124K13, J075124M02, J075124M07, J075124N23, J075125A13, J075125B13, J075125C06, J075125C17, J075125D14, J075125E06, J075125H12, J075125I07, J075125J01, J075125M24, J075125P05, J075126B03, J075126F12, J075126F14, J075126H06, J075126K16, J075126M15, J075126N03, J075126N07, J075126O13, J075127E01, J075127E17, J075127H07, J075127L02, J075127L09, J075128G12, J075128H19, J075128J16, J075128M07, J075128M19, J075129C05, J075129J03, J075129J21, J075129L18, J075129M10, J075130A08, J075130B14, J075130D05, J075130E19, J075130P14, J075131D10, J075131F19, J075131L04, J075131P17, J075132H07, J075132H21, J075132K03, J075132K18, J075132O05, J075133A19, J075133D03, J075133E03, J075133E23, J075133M18, J075133O20, J075134C02, J075134C18, J075134F06, J075134F16, J075134K01, J075134K16, J075134M05, J075134P15, J075135B13, J075135H10, J075136B06, J075136F22, J075136H21, J075136K21, J075136L06, J075137A10, J075137I12, J075137P03, J075137P12, J075137P13, J075138A10, J075138C05, J075138C21, J075138J12, J075138K09, J075138K23, J075138L02, J075138P22, J075139B21, J075139I24, J075139O21, J075140C19, J075140E05, J075140F12, J075140I18, J075140J21, J075141B12, J075141D10, J075141E21, J075141F03, J075141H05, J075141H23, J075141P19, J075142B04, J075142B17, J075142F03, J075142G15, J075142H13, J075142J03, J075142L11, J075142L13, J075142L15, J075142M06, J075142O04, J075142O15, J075143A21, J075143B10, J075143C07, J075143C15, J075143D03, J075143D20, J075143D23, J075143F09, J075143G02, J075143I24, J075143L05, J075143M05, J075143N01, J075144B08, J075144C04, J075144F16, J075144I04, J075144J22, J075145A05, J075145B05, J075145D07, J075145D13, J075145G18, J075145H09, J075145I12, J075145L03, J075145L08, J075145L22, J075145M11, J075146D05, J075146D16, J075146F10, J075146G13, J075146H01, J075147A16, J075147B22, J075147E05, J075147J02, J075148E12, J075148F11, J075148J04, J075148M11, J075148M16, J075148P17, J075150B08, J075150C12, J075150J08, J075150M18, J075150N08, J075150N12, J075150N14, J075151H08, J075151I04, J075151M12, J075151N18, J075151O19, J075152A02, J075152C03, J075152D02, J075152E05, J075152E06, J075152F09, J075152G16, J075152I02, J075152I10, J075152N06, J075153B13, J075153C10, J075153E04, J075153L19, J075153L24, J075153N02, J075154A06, J075154D07, J075154F24, J075154H17, J075155A08, J075155A14, J075155F16, J075155F18, J075155K18, J075155L23, J075155M21, J075155P05, J075156D18, J075156M05, J075156N18, J075157A06, J075157C14, J075157L11, J075157O08, J075158B01, J075158B19, J075158B20, J075158D11, J075158J17, J075158L03, J075158N07, J075159A08, J075159D22, J075159G14, J075159H16, J075159K10, J075160E14, J075160E18, J075160F14, J075160J21, J075160M19, J075161B04, J075161F23, J075161I22, J075161K17, J075161M04, J075162H19, J075162I21, J075162J08, J075162K18, J075162M19, J075163B19, J075163D03, J075163G23, J075163N14, J075163P19, J075164C06, J075164C10, J075164G24, J075164H05, J075164I07, J075164J09, J075164J16, J075164O09, J075165B18, J075165D09, J075165E24, J075165G21, J075165J11, J075165K16, J075165M03, J075165P21, J075166B19, J075166C05, J075166D01, J075166E03, J075166M06, J075166P13, J075167B19, J075167C16, J075167F06, J075167F08, J075167G23, J075167K16, J075167L13, J075167P05, J075168A17, J075168N08, J075168P09, J075168P13, J075169D18, J075169G07, J075170A12, J075170I05, J075170K19, J075170L23, J075170N09, J075171A02, J075171J11, J075171J16, J075171M16, J075171N16, J075172A22, J075172B04, J075172D20, J075172H21, J075172I19, J075172M07, J075172N04, J075172N13, J075172O15, J075173A03, J075173C12, J075173D22, J075173G10, J075173I19, J075174A21, J075174B11, J075174F03, J075174G13, J075174H07, J075175A22, J075175C03, J075175H10, J075175H17, J075175J21, J075175N10, J075175P20, J075176A03, J075176B07, J075176D16, J075176E09, J075176F14, J075176G18, J075176I24, J075176K05, J075176L14, J075176O12, J075176O15, J075177C06, J075177F20, J075177I01, J075178B02, J075178D03, J075178F16, J075178G01, J075178L09, J075178N21, J075179A19, J075179F02, J075179G19, J075179J17, J075180B19, J075180C20, J075180D21, J075180M02, J075181B09, J075181C03, J075181C17, J075181D22, J075181I01, J075181I07, J075181K20, J075181L15, J075181L24, J075181M13, J075181P14, J075182B02, J075182P16, J075183E19, J075183K22, J075184B06, J075184D11, J075184F24, J075184H23, J075184J01, J075184K19, J075185C22, J075185D19, J075185E19, J075185G01, J075186A16, J075186E05, J075186F10, J075186F14, J075186F24, J075186K24, J075186L10, J075186O21, J075187C22, J075187E12, J075187F03, J075187K23, J075187L01, J075187N11, J075187N19, J075188B08, J075188B09, J075188B19, J075188C13, J075188F10, J075188I09, J075188P03, J075188P09, J075189F03, J075189F23, J075189I20, J075189K03, J075189N17, J075190B16, J075190J07, J075190J16, J075190J23, J075190M02, J075190N23, J075191A16, J075191C07, J075191F03, J075191I20, J075191I21, J075191K07, J075191M24, J075191N20, J075191O13, J075191P11, J075191P13, J075192A10, J075192C14, J075192D16, J075192E03, J075192E21, J075192H04, J075192L03, J075192O07, J075193A22, J075193D19, J075193F20, J075193P17, J075194N22, J075195F05, J075195F22, J075195I04, J075195L17, J075195O15, J075196C15, J075196D21, J075196E22, J075196H08, J075196I03, J075196I08, J075196N03, J075196O14, J075196O15, J075197A09, J075197F19, J075197P10, J075198I21, J075198J11, J075199H07, J075199H18, J075199M21, J075199P15, J090017A04, J090066L20, X60979
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGATGGGC+57738245773831AB016503, J065026L09, J065043L20, J065046A08, J065191B13, J065199C04, J075001B09, J075001F18, J075001H12, J075002D19, J075002F19, J075002J08, J075002K02, J075002M04, J075002M10, J075003A21, J075003D10, J075003E15, J075003E19, J075003F02, J075003K11, J075003L11, J075004C08, J075004E04, J075004F12, J075004H19, J075004I03, J075005C16, J075005F10, J075005J19, J075006F10, J075006I11, J075006I20, J075006J02, J075006L23, J075006N23, J075007B14, J075007C05, J075007D19, J075007G10, J075007H04, J075007H11, J075007K20, J075007M04, J075007N01, J075007N07, J075007N11, J075007N17, J075007N18, J075007O07, J075007O15, J075008D05, J075008G06, J075008K17, J075008L04, J075008N22, J075008O20, J075009A17, J075009H12, J075009H17, J075009K24, J075009L22, J075009M05, J075009O08, J075010C16, J075010D02, J075010K21, J075010K22, J075010L08, J075010L24, J075010N21, J075010O09, J075010P11, J075010P12, J075011B05, J075011D06, J075011J18, J075012A03, J075012C02, J075012I22, J075012J19, J075012L13, J075012M24, J075013B21, J075013E12, J075013H01, J075013H10, J075013I06, J075013L09, J075013M16, J075013M17, J075013P09, J075014A08, J075014E03, J075014H11, J075014O22, J075015B10, J075015D21, J075015G11, J075015H13, J075015H17, J075015I11, J075015J18, J075015L24, J075015P11, J075016A11, J075016A18, J075016B01, J075016B09, J075016F21, J075016I06, J075016L16, J075016M24, J075017B01, J075017B18, J075017C14, J075017H03, J075017H13, J075017I12, J075017K10, J075017L24, J075017M04, J075017N03, J075019C09, J075019J20, J075019L19, J075019P20, J075020A01, J075020C16, J075020H23, J075020L24, J075021C11, J075021F02, J075021F16, J075021I01, J075021I19, J075021J09, J075021K11, J075021M05, J075021M17, J075021P06, J075022H01, J075022K22, J075023C09, J075023D11, J075023G03, J075023G14, J075023H19, J075023I17, J075023M02, J075023N05, J075023N11, J075023N16, J075023O22, J075024C24, J075024E01, J075024F10, J075024I02, J075024J08, J075024K01, J075025D07, J075025G10, J075025J16, J075025L03, J075025P13, J075026D14, J075026D21, J075026E21, J075026F23, J075026K08, J075026N18, J075026O22, J075027C07, J075027F19, J075027G07, J075027H08, J075027I11, J075027L02, J075027P10, J075028A18, J075028C01, J075028F14, J075028G04, J075028H06, J075028I21, J075028L20, J075028L23, J075028N18, J075028O10, J075028O18, J075028P09, J075029A14, J075029J04, J075029M14, J075029P13, J075030A15, J075030B06, J075030D05, J075030D23, J075030G21, J075030J18, J075030L07, J075030M16, J075030N18, J075030N19, J075031D14, J075031I04, J075031M12, J075031O19, J075032C16, J075032E06, J075032G18, J075032I20, J075032K11, J075032K19, J075032N08, J075033B17, J075033B19, J075033D24, J075033H17, J075033L07, J075033L11, J075033L19, J075033P20, J075034A07, J075034C14, J075034E15, J075034F10, J075034I22, J075034J12, J075034J19, J075034K21, J075034O04, J075034O12, J075035B05, J075035B06, J075035D14, J075035E16, J075035L10, J075035M05, J075035M12, J075036F22, J075036K04, J075036K17, J075036P12, J075037F03, J075037G19, J075037H15, J075037L23, J075037M17, J075037O08, J075038E13, J075038G15, J075038N24, J075038O09, J075039F24, J075039O16, J075039O17, J075040D08, J075040D23, J075040H18, J075040I07, J075040L03, J075040N15, J075040N18, J075041A11, J075041B17, J075041G03, J075041M13, J075041M24, J075041N22, J075042A04, J075042C05, J075042C20, J075042D03, J075042E01, J075042E07, J075042G10, J075042I24, J075042M05, J075043D12, J075043M20, J075044A10, J075044B12, J075044C20, J075044G17, J075044H22, J075044M22, J075044P19, J075044P22, J075045B16, J075045C20, J075045D05, J075045E12, J075045E17, J075045N03, J075045N09, J075046F16, J075046G03, J075046K14, J075046K15, J075046K18, J075046N21, J075047B02, J075047D15, J075047F13, J075047I12, J075048B22, J075048E10, J075048F12, J075048K08, J075048N10, J075048N18, J075048O15, J075049F16, J075049J05, J075049O14, J075049P17, J075050A11, J075050A18, J075050E21, J075050H07, J075050I21, J075050K05, J075050K12, J075050K16, J075050N22, J075050P16, J075051C01, J075051D08, J075051F09, J075051G05, J075051G22, J075051H13, J075051L13, J075051M11, J075051N12, J075052F02, J075052G22, J075052H10, J075052H16, J075052J18, J075052N06, J075052P14, J075053C15, J075053L06, J075053N12, J075054C04, J075054D17, J075054F06, J075054G08, J075054G15, J075054H21, J075054I07, J075054J10, J075054L06, J075054L17, J075054N04, J075055D08, J075055I19, J075055J05, J075055N13, J075056C20, J075056F20, J075056I19, J075056K18, J075056L07, J075056O03, J075057J08, J075057M13, J075057N19, J075058B21, J075058C06, J075058I17, J075058J02, J075058L10, J075058N02, J075058N10, J075058O13, J075059B11, J075059E18, J075059G22, J075059H11, J075059I02, J075059M19, J075060B04, J075060D07, J075060D18, J075060E04, J075060E10, J075060G06, J075060J22, J075060K08, J075060K12, J075060K18, J075060L24, J075060M17, J075060P10, J075061B09, J075061G02, J075061H23, J075061J20, J075061K22, J075061M05, J075062C22, J075062G20, J075062H19, J075062K04, J075062N17, J075063A14, J075063E03, J075063E06, J075063G23, J075064C21, J075064H04, J075064L04, J075064L09, J075065B09, J075065F05, J075065F19, J075065F22, J075065G02, J075065L14, J075065M19, J075065N07, J075066E20, J075066E21, J075066J04, J075066N10, J075066N14, J075067A04, J075067G23, J075067K13, J075067L11, J075068H01, J075068J20, J075068K05, J075069B13, J075069I24, J075069J22, J075069K08, J075069K09, J075069L16, J075070D12, J075070F19, J075070I17, J075070K14, J075070L21, J075070N24, J075070P03, J075071C23, J075071K18, J075071L02, J075072B21, J075072C17, J075072D08, J075072G21, J075072I16, J075072L08, J075072N12, J075073C04, J075073C21, J075073E13, J075073E21, J075073K12, J075073P03, J075073P04, J075073P05, J075074A08, J075074B04, J075074B09, J075074H24, J075074I04, J075074K11, J075074L03, J075074L16, J075074O14, J075075A01, J075075A07, J075075B06, J075075D21, J075075H22, J075075K07, J075075L03, J075075M20, J075075O15, J075075P07, J075076A18, J075076F10, J075076G21, J075076H03, J075076M04, J075076O07, J075076P06, J075077B03, J075077C17, J075077D14, J075077L18, J075078A09, J075078B22, J075078K22, J075078M23, J075078N02, J075079B09, J075079B10, J075079B13, J075079F18, J075079G15, J075079L08, J075079P08, J075080E14, J075080J12, J075080L08, J075081A04, J075081C12, J075081D08, J075081G24, J075081I06, J075081I19, J075081K04, J075081K11, J075081M14, J075081N08, J075082A03, J075082B02, J075082J05, J075083B13, J075083H05, J075083H17, J075083I08, J075083I22, J075083N17, J075084D17, J075084H21, J075084P20, J075085A05, J075085C22, J075085J04, J075085K17, J075085M07, J075086A09, J075086A22, J075086B16, J075086B19, J075086C13, J075086F15, J075086G14, J075086I20, J075086J02, J075086M20, J075086N07, J075086N09, J075087A09, J075087D07, J075087F12, J075087H07, J075087J10, J075087K16, J075087L10, J075087P19, J075088A11, J075088C21, J075088D05, J075088I05, J075088K13, J075088M18, J075088O11, J075088O20, J075088P09, J075089G21, J075089O20, J075089P18, J075090D07, J075090G23, J075090H02, J075090H07, J075090K04, J075091E06, J075091F04, J075091F10, J075091H14, J075091H22, J075091J21, J075091L08, J075091N21, J075091O04, J075091P03, J075092F15, J075092H04, J075092I21, J075092J16, J075092J21, J075092L17, J075092L24, J075092O18, J075093C23, J075093D02, J075093E15, J075093F01, J075093I24, J075093L24, J075093M04, J075094A04, J075094C23, J075094I03, J075094K07, J075094P06, J075095H19, J075095L11, J075095N07, J075096B12, J075096D21, J075096N13, J075097A08, J075097C09, J075097E14, J075097G15, J075097G19, J075097H05, J075097K17, J075097L13, J075097N11, J075098D18, J075098F08, J075098F14, J075098M09, J075098O17, J075099B16, J075099E14, J075099K08, J075099N03, J075099O06, J075100C01, J075100F15, J075100F17, J075100N15, J075101B19, J075101C10, J075101D02, J075101D21, J075101F09, J075101G11, J075101N14, J075102E20, J075102E22, J075102G11, J075102M11, J075102P08, J075102P16, J075103B20, J075103C19, J075103E12, J075103K03, J075104D07, J075104D23, J075104F03, J075104F08, J075104K06, J075104K11, J075104K18, J075104N01, J075104N13, J075104O19, J075105B16, J075105C24, J075105D03, J075105H18, J075105I17, J075105J24, J075105K17, J075105M18, J075105O11, J075105P18, J075106B21, J075106D14, J075106F22, J075106M02, J075107F05, J075107H17, J075108B14, J075108C06, J075108K13, J075108L22, J075108O16, J075109B03, J075109C19, J075110C03, J075110C05, J075110D24, J075110G17, J075110J23, J075110K18, J075110P03, J075111B22, J075111C16, J075111E09, J075111F21, J075111G13, J075111I07, J075111O14, J075112A21, J075112N01, J075112N12, J075114B01, J075114C03, J075114F10, J075114K23, J075114N15, J075114N16, J075115G17, J075115K22, J075116C09, J075116C24, J075116F03, J075116H08, J075116J03, J075116K19, J075116L05, J075116L17, J075116O17, J075117F22, J075117K05, J075117L05, J075117N08, J075117N11, J075117P18, J075118B02, J075118C17, J075118D10, J075118D24, J075118E16, J075118H14, J075118I20, J075118L14, J075118L23, J075118M04, J075118O17, J075119A01, J075119A03, J075119A05, J075119A17, J075119B05, J075119C19, J075119D04, J075119D09, J075119G01, J075119H22, J075119J21, J075119L06, J075119O09, J075119P04, J075119P16, J075119P20, J075120B03, J075120F08, J075120F14, J075120M03, J075120N02, J075120N23, J075120O19, J075121I24, J075121J23, J075121L20, J075121N02, J075121P09, J075122D20, J075122G16, J075122G18, J075122J22, J075122L22, J075122M19, J075122O11, J075123D10, J075123J15, J075123J20, J075123L15, J075123M22, J075123P22, J075124C01, J075124D02, J075124D21, J075124E24, J075124H13, J075124I04, J075124I16, J075124J20, J075124K13, J075124M02, J075124M07, J075124N23, J075125A13, J075125B13, J075125C06, J075125C17, J075125D14, J075125E06, J075125H12, J075125I07, J075125J01, J075125M24, J075125P05, J075126B03, J075126F12, J075126F14, J075126H06, J075126K16, J075126M15, J075126N03, J075126N07, J075126O13, J075127E01, J075127E17, J075127H07, J075127L02, J075127L09, J075128G12, J075128H19, J075128J16, J075128M07, J075128M19, J075129C05, J075129J03, J075129J21, J075129L18, J075129M10, J075130A08, J075130B14, J075130D05, J075130E19, J075130P14, J075131D10, J075131F19, J075131L04, J075131P17, J075132H07, J075132H21, J075132K03, J075132K18, J075132O05, J075133A19, J075133D03, J075133E03, J075133E23, J075133M18, J075133O20, J075134C02, J075134C18, J075134F06, J075134F16, J075134K01, J075134K16, J075134M05, J075134P15, J075135B13, J075135H10, J075136B06, J075136F22, J075136H21, J075136K21, J075136L06, J075137A10, J075137I12, J075137P03, J075137P12, J075137P13, J075138A10, J075138C05, J075138C21, J075138J12, J075138K09, J075138K23, J075138L02, J075138P22, J075139B21, J075139I24, J075139O21, J075140C19, J075140E05, J075140F12, J075140I18, J075140J21, J075141B12, J075141D10, J075141E21, J075141F03, J075141H05, J075141H23, J075141P19, J075142B04, J075142B17, J075142F03, J075142G15, J075142H13, J075142J03, J075142L11, J075142L13, J075142L15, J075142M06, J075142O04, J075142O15, J075143A21, J075143B10, J075143C07, J075143C15, J075143D03, J075143D20, J075143D23, J075143F09, J075143G02, J075143I24, J075143L05, J075143M05, J075143N01, J075144B08, J075144C04, J075144F16, J075144I04, J075144J22, J075145A05, J075145B05, J075145D07, J075145D13, J075145G18, J075145H09, J075145I12, J075145L03, J075145L08, J075145L22, J075145M11, J075146D05, J075146D16, J075146F10, J075146G13, J075146H01, J075147A16, J075147B22, J075147E05, J075147J02, J075148E12, J075148F11, J075148J04, J075148M11, J075148M16, J075148P17, J075150B08, J075150C12, J075150J08, J075150M18, J075150N08, J075150N12, J075150N14, J075151H08, J075151I04, J075151M12, J075151N18, J075151O19, J075152A02, J075152C03, J075152D02, J075152E05, J075152E06, J075152F09, J075152G16, J075152I02, J075152I10, J075152N06, J075153B13, J075153C10, J075153E04, J075153L19, J075153L24, J075153N02, J075154A06, J075154D07, J075154F24, J075154H17, J075155A08, J075155A14, J075155F16, J075155F18, J075155K18, J075155L23, J075155M21, J075155P05, J075156D18, J075156M05, J075156N18, J075157A06, J075157C14, J075157L11, J075157O08, J075158B01, J075158B19, J075158B20, J075158D11, J075158J17, J075158L03, J075158N07, J075159A08, J075159D22, J075159G14, J075159H16, J075159K10, J075160E14, J075160E18, J075160F14, J075160J21, J075160M19, J075161B04, J075161F23, J075161I22, J075161K17, J075161M04, J075162H19, J075162I21, J075162J08, J075162K18, J075162M19, J075163B19, J075163D03, J075163G23, J075163N14, J075163P19, J075164C06, J075164C10, J075164G24, J075164H05, J075164I07, J075164J09, J075164J16, J075164O09, J075165B18, J075165D09, J075165E24, J075165G21, J075165J11, J075165K16, J075165M03, J075165P21, J075166B19, J075166C05, J075166D01, J075166E03, J075166M06, J075166P13, J075167B19, J075167C16, J075167F06, J075167F08, J075167G23, J075167K16, J075167L13, J075167P05, J075168A17, J075168N08, J075168P09, J075168P13, J075169D18, J075169G07, J075170A12, J075170I05, J075170K19, J075170L23, J075170N09, J075171A02, J075171J11, J075171J16, J075171M16, J075171N16, J075172A22, J075172B04, J075172D20, J075172H21, J075172I19, J075172M07, J075172N04, J075172N13, J075172O15, J075173A03, J075173C12, J075173D22, J075173G10, J075173I19, J075174A21, J075174B11, J075174F03, J075174G13, J075174H07, J075175A22, J075175C03, J075175H10, J075175H17, J075175J21, J075175N10, J075175P20, J075176A03, J075176B07, J075176D16, J075176E09, J075176F14, J075176G18, J075176I24, J075176K05, J075176L14, J075176O12, J075176O15, J075177C06, J075177F20, J075177I01, J075178B02, J075178D03, J075178F16, J075178G01, J075178L09, J075178N21, J075179A19, J075179F02, J075179G19, J075179J17, J075180B19, J075180C20, J075180D21, J075180M02, J075181B09, J075181C03, J075181C17, J075181D22, J075181I01, J075181I07, J075181K20, J075181L15, J075181L24, J075181M13, J075181P14, J075182B02, J075182P16, J075183E19, J075183K22, J075184B06, J075184D11, J075184F24, J075184H23, J075184J01, J075184K19, J075185C22, J075185D19, J075185E19, J075185G01, J075186A16, J075186E05, J075186F10, J075186F14, J075186F24, J075186K24, J075186L10, J075186O21, J075187C22, J075187E12, J075187F03, J075187K23, J075187L01, J075187N11, J075187N19, J075188B08, J075188B09, J075188B19, J075188C13, J075188F10, J075188I09, J075188P03, J075188P09, J075189F03, J075189F23, J075189I20, J075189K03, J075189N17, J075190B16, J075190J07, J075190J16, J075190J23, J075190M02, J075190N23, J075191A16, J075191C07, J075191F03, J075191I20, J075191I21, J075191K07, J075191M24, J075191N20, J075191O13, J075191P11, J075191P13, J075192A10, J075192C14, J075192D16, J075192E03, J075192E21, J075192H04, J075192L03, J075192O07, J075193A22, J075193D19, J075193F20, J075193P17, J075194N22, J075195F05, J075195F22, J075195I04, J075195L17, J075195O15, J075196C15, J075196D21, J075196E22, J075196H08, J075196I03, J075196I08, J075196N03, J075196O14, J075196O15, J075197A09, J075197F19, J075197P10, J075198I21, J075198J11, J075199H07, J075199H18, J075199M21, J075199P15, J090017A04, J090066L20, X60979
 OsREG607TGATGGGC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.