version
PlantPromoterDB promoter information of J075141I12

Summary of Gene (J075141I12)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0130800        NCBI 
Gene model J075141I12  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 1643390-1642191)

Genome position     
from initiation codon
014-002-A12         
AK069863            
J023037L12          
J065013F22          
J065021C09          
J065065E23          
J065066L24          
J065093N06          
J065135B12          
J065142J19          
J065163M21          
J065167K01          
J065178F24          
J065179A22          
J065196O19          
J075041I03          
J075071E18          
J075071F17          
J075125K04          
J075142M02          
J075150G22          
J075151J04          
J075195A03          
J080023G18          
J080076P03          
J090051F21          
J090082L05          
U74296              
TSS from cDNA
TSS information
J075141I12                       5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075141I12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-1642800-410

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGGTATAAACC-16428251642834-435-444
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGATCCG-16428751642882-485-492
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 
REGCGCCACGTGT-16429101642919-520-529
 OsREG448CGCCACGT   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  CCACGTGT PPDB MotifACGT  PLACE Motif 
REGCGGATCGG-16429221642929-532-539
 OsREG541CGGATCGG PPDB Motif  PLACE Motif 
REGGGTCCAGA-16429511642958-561-568
 OsREG649GGTCCAGA PPDB Motif  PLACE Motif 
REGATCCCCCA-16429761642983-586-593
 OsREG482ATCCCCCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.