version
PlantPromoterDB promoter information of J075142L01

Summary of Gene (J075142L01)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0643000        NCBI 
Gene model J075142L01  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 27075884-27074685)

Genome position     
from initiation codon
AK067701            
J013032G04          
J013044B17          
J013114M13          
J023133A02          
J043022A07          
J075045J04          
J075046G09          
J075046O21          
J075054A05          
J075100J15          
J075100L13          
J075111I06          
J075124O04          
J075153I01          
J075172N17          
J075190A04          
J090076I16          
J100056O17          
TSS from cDNA
TSS information
J075142L01                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075142L01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-27075122-238

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCACACG-2707516827075176-284-292
 OsREG535CCCCACAC  PPDB Motif  PLACE Motif 
 OsREG526 CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGGCCGGCCCACCACCAAC-2707518427075200-300-316
 OsREG615GCCGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC        PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGCCCACC       PPDB MotifGCCCA  PLACE Motif 
 OsREG599    GCCCACCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG527     CCCACCAC     PPDB MotifGCCCA  PLACE Motif 
 OsREG520         CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGGTGTGGGCTTG-2707522327075233-339-349
 OsREG598GTGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG461 TGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG427  GTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG496   TGGGCTTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.