version
PlantPromoterDB promoter information of J075143H07

Summary of Gene (J075143H07)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0661800        NCBI 
Gene model J075143H07  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 34177040-34175841)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J075143H07                       5'->3' (-)
Promoter sequence

 
006-090-F11         
AB037150            
AK061835            
AK103551            
AK104076            
J013093O22          
J013157M03          
J023014C08          
J023027D02          
J023042D23          
J023047F07          
J033025N04          
J033048F09          
J033103A21          
J033119A06          
J033132F12          
J033140J24          
J053071I02          
J053077D04          
J065139H14          
J065151N12          
J065162O03          
J065168J04          
J090067G20          
J090072N04          
J090086L10          
J090087A05          
J090095N01          
J100039F24          
J100079J06          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075143H07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+34175994J100039F24, J053077D04, 006-090-F11, J090095N01
TSS clone peakAclone+34176042J100039F24, J053077D04, 006-090-F11, J090095N01
TSS cloneGclone+34176052J100039F24, J053077D04, 006-090-F11, J090095N01
TSS cloneAclone+34176066J100039F24, J053077D04, 006-090-F11, J090095N01

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGTTGGTGGTCATGGGCCAAAAAGCCCAACT+3417584334175872006-090-F11, J053077D04, J090095N01, J100039F24
 OsREG520GTTGGTGG                       PPDB MotifCCAACGG  PLACE Motif 
 OsREG609        TCATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG517         CATGGGCC              PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488          ATGGGCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG660           TGGGCCAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG419                  AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG421                   AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426                    AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458                     AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479                      GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGTCTGGACC+3417589034175897006-090-F11, J053077D04, J090095N01, J100039F24
 OsREG649TCTGGACC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.