version
PlantPromoterDB promoter information of J075143K13

Summary of Gene (J075143K13)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0588900        NCBI 
Gene model J075143K13  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 24834948-24833749)

Genome position     
from initiation codon
AK069966            
J023038A10          
J065061J23          
J065176O08          
TSS from cDNA
TSS information
J075143K13                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075143K13

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-24834658-710

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGGCCCAGCTAGGCCCAATT-2483470124834722-753-774
 OsREG584GACGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA              PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565  CGGCCCAG             PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG656           TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471            AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492             GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433              GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCATTGGGCCTGG-2483472824834745-780-797
 OsREG421AAAGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT          PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT         PPDB MotifGCCCA  PLACE Motif 
 OsREG492       ATTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG471        TTGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG513         TGGGCCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG524          GGGCCTGG PPDB MotifGCCCA  PLACE Motif 
REGGGACGGCCCAGG-2483474824834759-800-811
 OsREG624GGACGGCC     PPDB Motif  PLACE Motif 
 OsREG584 GACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565   CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550    GGCCCAGG PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCTA-2483476824834778-820-830
 OsREG422AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.