version
PlantPromoterDB promoter information of J075145H10

Summary of Gene (J075145H10)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0190950        NCBI 
Gene model J075145H10  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 5046301-5047500)

Genome position     
from initiation codon
J075001E02          
J075117E23          
J075117F23          
J075144M12          
J075186B15          
TSS from cDNA
TSS information
J075145H10                       5'->3' (+)
Promoter sequence











 
AK111037            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence












 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075145H10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+5047299-2

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCTCTCCTTCCTCT+504732150473372036
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGCCCACCC+50470115047021-290-280
 OsREG653GTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600   GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGCGGATCGG+50470365047043-265-258
 OsREG541CGGATCGG PPDB Motif  PLACE Motif 
REGTTTTGGGCCCAACC+50471285047141-173-160
 OsREG592TTTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626     GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595      GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCCCCAC+50471795047191-122-110
 OsREG581CTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639 TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG613     GCCCCCAC PPDB Motif  PLACE Motif 
REGCACGGCCCGGCCCAAATTGGGC+50472315047252-70-49
 OsREG504CACGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG              PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG             PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC            PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC           PPDB Motif  PLACE Motif 
 OsREG538     CCCGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG542      CCGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG563       CGGCCCAA        PPDB MotifGCCCA  PLACE Motif 
 OsREG625        GGCCCAAA       PPDB MotifGCCCA  PLACE Motif 
 OsREG493         GCCCAAAT      PPDB MotifGCCCA  PLACE Motif 
 OsREG433              AATTGGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-5047098AK111037, AK111037

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGTGGGGGCCCAAG-50471795047191AK111037
 OsREG613GTGGGGGC      PPDB Motif  PLACE Motif 
 OsREG647   GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG639    GGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581     GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGGCCCAATTTGGGCCGGGCCGTG-50472315047252AK111037
 OsREG433GCCCAATT               PPDB MotifGCCCA  PLACE Motif 
 OsREG493     ATTTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG625      TTTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG563       TTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG542        TGGGCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG538         GGGCCGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG614          GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616           GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544            CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG446             CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG504              GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCCGGGCCCATTA-50472765047294AK111037
 OsREG592TTTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG          PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC       PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543       CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566        CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG489         GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431          GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610           GCCCATTA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.