version
PlantPromoterDB promoter information of J075147L21

Summary of Gene (J075147L21)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0111200        NCBI 
Gene model J075147L21  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 577464-578663)

Genome position     
from initiation codon
009-033-A06         
AK101693            
J065006E13          
J075001D12          
J075005J18          
J075009L08          
J075012M21          
J075019K17          
J075020D07          
J075041D11          
J075051C03          
J075060C05          
J075079N09          
J075094B04          
J075108E08          
J075115G05          
J075154O06          
J075161G12          
J075168J11          
J075168L11          
J075174F22          
J090068G02          
TSS from cDNA
TSS information
J075147L21                       5'->3' (+)
Promoter sequence









 
J065035F14          
J065039N23          
J065104N01          
J065147F17          
J065171L05          
J065207A03          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075147L21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+578383-81

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTTGGAT+578143578150-321-314
 OsREG481CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 
REGCGGACGGCGCGGGTGGGTGGGCCCCACA+578226578253-238-211
 OsREG562CGGACGGC                     PPDB Motif  PLACE Motif 
 OsREG439      GCGCGGGT               PPDB Motif  PLACE Motif 
 OsREG528         CGGGTGGG            PPDB MotifGCCCA  PLACE Motif 
 OsREG600              GGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628               GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640                GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647                 TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641                  GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631                   GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611                    GCCCCACA PPDB Motif  PLACE Motif 
REGACGCGTGGGCCAC+578266578278-198-186
 OsREG443ACGCGTGG      PPDB Motif  PLACE Motif 
 OsREG530 CGCGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG602  GCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571   CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654    GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653     TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCC+578329578336-135-128
 OsREG538CCCGGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.