version
PlantPromoterDB promoter information of J075151F01

Summary of Gene (J075151F01)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0381400        NCBI 
Gene model J075151F01  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 18438016-18436817)

Genome position     
from initiation codon
014-036-H12         
014-085-H12         
AK102039            
J075011E17          
J075057P04          
J075066K19          
J075068L13          
J075074J21          
J075076N10          
J075078L14          
J075099O16          
J075120C05          
J075140I24          
J075148F21          
J075151I10          
J075156M15          
J075191F07          
J075192K20          
J075195M22          
TSS from cDNA
TSS information
J075151F01                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075151F01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-18437102-86

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGCCTATATATC-1843713118437142-115-126
Y PatchTTCTCCTC-1843710318437110-87-94
Y PatchCCCCTCTCCCC-1843714218437152-126-136
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCATCCACCCACACGTGTC-1843715418437173-138-157
 OsREG534CCCATCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG515  CATCCACC           PPDB Motif  PLACE Motif 
 OsREG526        CCCACACG     PPDB MotifGCCCA  PLACE Motif 
 OsREG509            CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGACACGTG-1843717918437187-163-171
 OsREG452CGACACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCACACG-1843718918437196-173-180
 OsREG573GCCACACG PPDB Motif  PLACE Motif 
REGACGTGTCC-1843720918437216-193-200
 OsREG451ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTGGCGTG-1843722818437235-212-219
 OsREG502GTGGCGTG PPDB Motif  PLACE Motif 
REGCGCGTCGCG-1843726818437276-252-260
 OsREG559CGCGTCGC  PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG PPDB Motif  PLACE MotifCGACG 
REGCGCGTCGC-1843734318437350-327-334
 OsREG559CGCGTCGC PPDB Motif  PLACE MotifCGACG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.