version
PlantPromoterDB promoter information of J075153K16

Summary of Gene (J075153K16)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0179901        NCBI 
Gene model J075153K16  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 1: 4177245-4176046)

Genome position     
from initiation codon
J075009I05          
J075058D09          
TSS from cDNA
TSS information
J075153K16                       5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075153K16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-4176246-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCCCT-41762524176259-7-14
Y PatchCCCCTCCT-41762654176272-20-27
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCCCATTGGGCCGAAA-41763194176337-74-92
 OsREG587GAGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT           PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT          PPDB MotifGCCCA  PLACE Motif 
 OsREG492       ATTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG563        TTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658         TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG642          GGGCCGAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG634           GGCCGAAA PPDB Motif  PLACE Motif 
REGTGCGGCCCAATTAGGGCCCAACT-41763524176374-107-129
 OsREG643TGCGGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA              PPDB MotifGCCCA  PLACE Motif 
 OsREG492   GGCCCAAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG433    GCCCAATT            PPDB MotifGCCCA  PLACE Motif 
 OsREG475            AGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG639             GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626              GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479               GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGGCCGAGAT-41764724176479-227-234
 OsREG485GCCGAGAT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.