version
PlantPromoterDB promoter information of J075161G07

Summary of Gene (J075161G07)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0101600        NCBI 
Gene model J075161G07  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 150122-148923)

Genome position     
from initiation codon
AF093636            
AK070447            
J065001A20          
J065019M17          
J065021H18          
J065061A17          
J065073L02          
J065099F17          
J065101C23          
J065121E23          
J065122N04          
J065141N05          
J065143N21          
J065161H09          
J065161J04          
J065162P20          
J065182K10          
J065184M05          
J065186H24          
J065189G21          
J065190N14          
J065191H08          
J065205H17          
J075001E03          
J075001H21          
J075003J23          
J075003K01          
J075005I11          
J075007F16          
J075017I11          
J075018O05          
J075019G24          
J075032D04          
J075032N13          
J075033C09          
J075033D11          
J075039A20          
J075058P12          
J075062E10          
J075062P16          
J075063C17          
J075066E07          
J075066I20          
J075075K21          
J075078F03          
J075082F10          
J075086G16          
J075087E07          
J075087K06          
J075087L04          
J075088B16          
J075088D02          
J075094H21          
J075094I24          
J075094K10          
J075095C18          
J075097B05          
J075099C13          
J075099H22          
J075099L16          
J075104K08          
J075118O06          
J075119E15          
J075124N06          
J075126G02          
J075127L24          
J075131E23          
J075140H06          
J075146I20          
J075146N24          
J075147I19          
J075155K07          
J075156C05          
J075164G01          
J075170J18          
J075172G17          
J075176G10          
J075178C05          
J075179G01          
J075181E24          
J080029D19          
J080034L11          
J080039G07          
J080062M23          
J080302A01          
J100042I15          
J100043G22          
J100056L12          
J100061A12          
J100073O20          
J100082I08          
TSS from cDNA
TSS information
J075161G07                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075161G07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-149187-65

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGCGCGAC-149282149290-160-168
 OsREG617GCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG557 CGCGCGAC PPDB MotifACGCGC  PLACE Motif 
REGAATGGGCTGC-149312149321-190-199
 OsREG432AATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG491 ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG591  TGGGCTGC PPDB MotifGCCCA  PLACE Motif 
REGGTGTGGGGGTGGGCCCACCT-149336149355-214-233
 OsREG535GTGTGGGG             PPDB Motif  PLACE Motif 
 OsREG600      GGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640        GTGGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628       GGTGGGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476            GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGGGGTGGGC-149390149397-268-275
 OsREG600GGGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCAGA-149414149424-292-302
 OsREG644TCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629   GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCACGT-149431149441-309-319
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449   GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.