version
PlantPromoterDB promoter information of J075166H17

Summary of Gene (J075166H17)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0150200        NCBI 
Gene model J075166H17  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 2645279-2646478)

Genome position     
from initiation codon
009-115-E06         
009-152-C07         
AK058680            
AK121635            
J033051C16          
J033123H15          
J065093I01          
J065197C05          
J075037B11          
J075114B08          
J075123N01          
J075129O04          
J075160H17          
J080310F11          
J080315P11          
J090025A22          
TSS from cDNA
TSS information
J075166H17                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075166H17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+2646087-192

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATATAAG+26460522646060-227-219
Y PatchCCTTCTCC+26460652646072-214-207
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCATGA+26458942645902-385-377
 OsREG467AGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609 GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGAGGTGGGCCAT+26459112645921-368-358
 OsREG476AGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654  GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487   TGGGCCAT PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCGGCCCATGT+26459232645940-356-339
 OsREG456AGATGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG615    GGGCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG517         GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437          GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGTGATGGGCCTC+26459572645967-322-312
 OsREG607TGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCT+26459692645976-310-303
 OsREG461TGTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCAATT+26460012646011-278-268
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433   GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGCTCGGCCCATCA+26460212646032-258-247
 OsREG575CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607    GCCCATCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.