version
PlantPromoterDB promoter information of J075169L16

Summary of Gene (J075169L16)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0501800        NCBI 
Gene model J075169L16  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 19005255-19006454)

Genome position     
from initiation codon
006-021-B07         
006-021-E12         
006-022-B08         
006-022-C09         
006-022-C12         
006-022-F10         
006-023-A09         
006-023-D02         
006-023-E06         
006-023-E11         
006-025-A01         
006-025-B07         
006-025-F04         
006-025-F11         
006-027-F05         
006-028-C02         
006-029-B01         
006-029-D09         
006-029-G02         
006-029-H08         
006-030-A02         
006-030-B05         
006-031-A01         
006-032-E09         
006-032-G10         
006-032-H11         
006-033-B08         
006-033-E11         
006-034-H01         
006-035-B09         
006-035-D08         
006-036-F01         
006-036-G01         
006-037-E12         
006-039-D07         
006-040-A03         
006-042-G11         
006-044-F11         
006-045-H04         
006-046-A09         
006-046-C12         
006-046-F10         
006-046-H08         
006-047-G05         
006-047-G06         
006-048-C05         
006-049-A07         
006-049-E03         
006-050-D08         
006-050-E02         
006-050-E07         
006-050-F11         
006-051-D04         
006-051-G07         
006-052-B06         
006-052-B11         
006-052-C06         
006-053-G03         
006-054-C01         
006-054-D09         
006-056-B11         
006-056-C07         
006-056-C12         
006-057-C05         
006-057-E08         
006-058-F03         
006-059-A03         
006-059-C12         
006-062-A06         
006-062-H04         
006-063-B08         
006-063-B10         
006-063-D11         
006-063-H07         
006-065-F08         
006-067-F07         
006-067-G04         
006-067-G12         
006-068-A12         
006-068-E08         
006-068-H01         
006-069-C01         
006-069-E08         
006-070-D05         
006-070-E10         
006-071-A02         
006-072-C01         
006-073-B07         
006-073-D02         
006-073-F06         
006-075-B10         
006-075-C01         
006-076-E10         
006-076-H12         
006-077-B10         
006-077-F12         
006-078-C04         
006-078-C10         
006-078-H11         
006-079-A05         
006-079-C01         
006-079-E04         
006-079-H06         
006-080-G05         
006-081-C07         
006-081-H07         
006-082-A09         
006-082-D02         
006-084-B11         
006-085-G10         
006-086-A05         
006-086-B05         
006-086-F09         
006-088-B09         
006-088-D02         
006-088-D10         
006-088-F05         
006-089-C06         
006-092-C07         
006-092-C08         
006-092-G09         
006-093-D12         
006-093-H10         
006-094-E07         
006-095-G01         
006-096-A10         
006-097-B06         
006-097-H12         
006-098-A08         
006-098-A10         
006-098-C10         
006-098-D02         
006-098-F10         
006-099-B08         
006-099-D02         
006-099-D05         
006-099-G10         
006-100-G06         
006-102-G09         
006-104-F06         
006-105-A12         
006-105-D04         
006-105-F05         
006-106-B01         
006-106-D05         
006-107-B01         
006-107-C02         
006-107-E01         
006-107-G03         
006-108-D09         
006-109-G01         
006-109-H07         
006-110-C04         
006-111-B11         
006-112-A02         
006-112-E03         
006-112-H04         
006-113-B07         
006-113-C08         
006-114-C12         
006-114-D06         
006-115-B06         
006-116-B01         
006-116-C02         
006-117-B05         
006-117-C06         
006-117-D10         
006-118-D04         
006-118-E12         
006-119-A06         
006-119-A09         
006-119-D02         
006-119-G07         
006-120-B03         
006-120-B07         
006-120-C01         
006-120-E04         
006-120-F11         
009-014-E11         
009-079-C06         
009-113-F07         
009-126-G04         
009-138-F01         
009-147-H02         
009-198-B08         
011-011-H03         
013-053-A06         
AK060886            
AK067715            
AK103920            
AK103937            
AK104080            
AK104649            
AK104760            
AK119163            
AK119188            
AK119515            
J013071M07          
J013098E19          
J013119C03          
J013135O08          
J023060H14          
J023075M20          
J023098P12          
J053061C24          
J053065C19          
J053094K19          
J075047M15          
J075083H07          
J075108K14          
J075112B16          
J075180P05          
J075194D02          
J080013D18          
J080016G20          
J080017E18          
J080018J18          
J080018N18          
J080036G23          
J080038O04          
J080038P09          
J080039N23          
J080043F01          
J080064J05          
J080067C16          
J080069B15          
J080071H03          
J080086L16          
J080088H01          
J080089B09          
J080090K14          
J080090N19          
J080093H07          
J080097B17          
J090008D23          
J090013H02          
J090031N19          
J090053G01          
TSS from cDNA
TSS information
J075169L16                       5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075169L16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+19006182-73
TSS cloneTclone+19006183-72
TSS cloneAclone+19006186-69
TSS cloneTclone+19006190-65
TSS clone peakAclone+19006191-64
TSS cloneGclone+19006203-52
TSS cloneAclone+19006206-49

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGTGGC+1900594119005948-314-307
 OsREG585GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCCCACA+1900598819005995-267-260
 OsREG611GCCCCACA PPDB Motif  PLACE Motif 
REGAGCCCACCAC+1900600419006013-251-242
 OsREG462AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599 GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527  CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTC+1900604619006053-209-202
 OsREG585GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.