version
PlantPromoterDB promoter information of J075169P20

Summary of Gene (J075169P20)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0214300        NCBI 
Gene model J075169P20  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 6292573-6291374)

Genome position     
from initiation codon
AK107328            
D11432              
D42139              
D42140              
D43657              
D43659              
J065067N22          
J065120B05          
J075001F02          
J075001F03          
J075001K10          
J075001N06          
J075003C19          
J075003C24          
J075003J10          
J075004B12          
J075004K23          
J075005G17          
J075006G20          
J075007E23          
J075007F23          
J075010P10          
J075013F16          
J075017H12          
J075019O13          
J075020G23          
J075021G15          
J075021H18          
J075021N23          
J075025B03          
J075028E10          
J075028L03          
J075029D23          
J075029J09          
J075030K21          
J075031K19          
J075032F16          
J075033G23          
J075033O22          
J075035J03          
J075039F14          
J075039M23          
J075040G14          
J075042B13          
J075044N03          
J075046G15          
J075050D15          
J075050F23          
J075050J08          
J075052G19          
J075053G08          
J075053M18          
J075055F01          
J075058D20          
J075059N03          
J075060K20          
J075067C21          
J075067P06          
J075070K22          
J075071E21          
J075073D13          
J075075B12          
J075078D07          
J075079C13          
J075080B08          
J075080G23          
J075080L15          
J075083G24          
J075083L01          
J075084O06          
J075085K07          
J075088F06          
J075089D03          
J075089F23          
J075089G03          
J075090A17          
J075091N19          
J075091O21          
J075093H12          
J075096H23          
J075096K21          
J075096P07          
J075098F24          
J075099B01          
J075104L24          
J075105E22          
J075106H15          
J075108G12          
J075108K15          
J075112B17          
J075115G04          
J075118J01          
J075119D14          
J075119G15          
J075120K02          
J075121J04          
J075122A19          
J075122N11          
J075123M09          
J075127M18          
J075129C12          
J075130M01          
J075134O08          
J075135C11          
J075135D24          
J075139C01          
J075140K20          
J075142B08          
J075147H09          
J075148P05          
J075149E14          
J075149J18          
J075150E12          
J075151F14          
J075152H11          
J075154H06          
J075161A14          
J075162G13          
J075164H12          
J075166E07          
J075166F06          
J075170M14          
J075172J02          
J075172L24          
J075176K04          
J075176L10          
J075177I19          
J075177L24          
J075177O18          
J075179L10          
J075185C01          
J075185L14          
J075186D02          
J075188J05          
J075188P08          
J075190G17          
J075191C22          
J075192J02          
J075194G13          
J075194J04          
J075194M12          
J075198L01          
J075199E19          
J075199G17          
J075199L04          
X62091              
TSS from cDNA
TSS information
J075169P20                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075169P20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-6291814-241

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAGCTATATATAAAAC-62918416291855-268-282
Y PatchTCCCTCTC-62918066291813-233-240
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCGTGGA-62919586291965-385-392
 OsREG636GGCGTGGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.