version
PlantPromoterDB promoter information of J075174C03

Summary of Gene (J075174C03)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0726400        NCBI 
Gene model J075174C03  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 31783138-31781939)

Genome position     
from initiation codon
AF136268            
AK065121            
AK068920            
AK119436            
AK120332            
AY302112            
D10752              
D11082              
J013001O19          
J013031L12          
J013042M09          
J013058E01          
J013058O09          
J013063J17          
J013066I24          
J013069F17          
J013096O13          
J013106E01          
J013118D19          
J013132K03          
J013162M11          
J013170H02          
J023006D03          
J023028B19          
J023031A13          
J023047H18          
J023050I24          
J023059N10          
J023086N05          
J023089H22          
J023102B19          
J023104N22          
J023131E11          
J023135O15          
J023140K16          
J033025G20          
J033025J03          
J033045B05          
J033067M08          
J033108P04          
J033113D04          
J043003D11          
J043009O20          
J043016P06          
J043017C21          
J043017J20          
J043021P15          
J043026I22          
J043032L15          
J043034G14          
J043039L16          
J043040F17          
J075003D02          
J075003O22          
J075005I24          
J075006N09          
J075011A22          
J075012K24          
J075017D01          
J075017I23          
J075023D17          
J075024B03          
J075025H05          
J075031D19          
J075034B02          
J075035C02          
J075037J12          
J075038M11          
J075039J17          
J075042P10          
J075046J20          
J075047F21          
J075053E05          
J075054D11          
J075054K06          
J075059E15          
J075061O04          
J075062I20          
J075066I12          
J075066L06          
J075071H12          
J075071N19          
J075074K01          
J075077H22          
J075083H18          
J075085F04          
J075085K09          
J075086C06          
J075086E06          
J075087A15          
J075090N02          
J075090N22          
J075091C04          
J075091G16          
J075097E04          
J075099E04          
J075102P22          
J075109B08          
J075109J02          
J075115I12          
J075117E17          
J075123C07          
J075124N05          
J075125E12          
J075126B11          
J075129E14          
J075130N15          
J075131I07          
J075141B13          
J075141B20          
J075144D23          
J075144N01          
J075147M24          
J075148L16          
J075151A22          
J075151D03          
J075151D04          
J075153E23          
J075156D02          
J075156P05          
J075162E23          
J075165J22          
J075166A06          
J075168H13          
J075170D04          
J075171C19          
J075173B12          
J075173M23          
J075185O11          
J075186G21          
J075187D06          
J075195G21          
J090003D18          
J090004I11          
J090005I12          
J090007D15          
J090007G20          
J090014G13          
J090014L08          
J090016J03          
J090018J04          
J090023P22          
J090025C19          
J090028F11          
J090028G01          
J090028H02          
J090034D19          
J090037B17          
J090037I11          
J090040F21          
J090040N24          
J090044M12          
J090045B13          
J090045M22          
J090048C10          
J090051J02          
J090052A03          
J090058O15          
J090062F11          
J090063F04          
J090063O17          
J090067D23          
J090069G15          
J090072I06          
J090073H18          
J090073L01          
J090075O21          
J090084K24          
J090087P11          
J090092B17          
J090094D05          
J100042H08          
J100049G07          
J100052F01          
J100052F19          
TSS from cDNA
TSS information
J075174C03                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075174C03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-31782805-117

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCGTCCACGTGGC-3178287631782890-188-202
 OsREG624GGCCGTCC        PPDB Motif  PLACE Motif 
 OsREG507       CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTTGGCCCAAA-3178290931782918-221-230
 OsREG660TTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGGACACGTGAAGGCCCATGG-3178292331782941-235-253
 OsREG509GACACGTG            PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG430        AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474         AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517          GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525           GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGACTGACAG-3178308831783095-400-407
 OsREG453ACTGACAG PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-31782387AK120332, J013058O09

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.