version
PlantPromoterDB promoter information of J075175F09

Summary of Gene (J075175F09)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0119400        NCBI 
Gene model J075175F09  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 1025404-1024205)

Genome position     
from initiation codon
006-021-C04         
006-076-E06         
006-096-E07         
AK060055            
AK102774            
J033107H09          
J053032D17          
J053089F12          
J065041B07          
J065200A22          
J065202K22          
J075017H14          
J075020D05          
J075093H07          
J075108F18          
J075120L23          
J075169J08          
J075196D06          
J090011H05          
J090091O05          
TSS from cDNA
TSS information
J075175F09                       5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075175F09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-1024747-343

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGTCCCACACG-10247951024807-391-403
 OsREG637TGGGTCCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 GGGTCCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG650  GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG526     CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCACGTGTCC-10249631024977-559-573
 OsREG660TTGGCCCA        PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC       PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG      PPDB MotifGCCCA  PLACE Motif 
 OsREG449   GCCCACGT     PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508    CCCACGTG    PPDB MotifACGT  PLACE Motif 
 OsREG434     CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509      CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451       ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTTTGGGCCCGGCCCACCT-10249951025013-591-609
 OsREG593GTTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG         PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG543    GGGCCCGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG616     GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614      GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538       CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542        CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564         CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628          GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476           GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGGACGGCCCATAT-10250351025046-631-642
 OsREG584GACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480    GCCCATAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.