version
PlantPromoterDB promoter information of J075180K24

Summary of Gene (J075180K24)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0306900        NCBI 
Gene model J075180K24  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 10965188-10963989)

Genome position     
from initiation codon
AK073626            
J033050J24          
TSS from cDNA
TSS information
J075180K24                       5'->3' (-)
Promoter sequence








 
J065032I03          
J065110H17          
J065156H13          
J065175P03          
J075007D24          
J100040M24          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence














 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075180K24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-10964274-86

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGTGGGGTCGTGGGCCCCAG-1096434510964366-157-178
 OsREG508CACGTGGG               PPDB MotifACGT  PLACE Motif 
 OsREG450 ACGTGGGG              PPDB MotifACGT  PLACE Motif 
 OsREG601         TCGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG571          CGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640           GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647            TGGGCCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG641             GGGCCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG580              GGCCCCAG PPDB Motif  PLACE Motif 
REGCATCCACC-1096449910964506-311-318
 OsREG515CATCCACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+10964515J065032I03, J075007D24, J065032I03, J065110H17, J065156H13, J065175P03, J100040M24

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCCTCCCTCCTCCTCCTCCTCCTCC+1096447010964498J065032I03, J065110H17, J065156H13, J065175P03, J075007D24, J100040M24
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTGGGGCCCACGACCCCACGTG+1096434510964366J065032I03, J065110H17, J065156H13, J065175P03, J075007D24, J100040M24
 OsREG580CTGGGGCC               PPDB Motif  PLACE Motif 
 OsREG641 TGGGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG647  GGGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GGGCCCAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG571    GGCCCACG           PPDB MotifGCCCA  PLACE Motif 
 OsREG601     GCCCACGA          PPDB MotifGCCCA  PLACE Motif 
 OsREG450             CCCCACGT  PPDB MotifACGT  PLACE Motif 
 OsREG508              CCCACGTG PPDB MotifACGT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.