version
PlantPromoterDB promoter information of J075193B15

Summary of Gene (J075193B15)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0785800        NCBI 
Gene model J075193B15  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 34245301-34246500)

Genome position     
from initiation codon
005-017-E01         
009-104-F05         
009-149-A09         
009-192-D08         
AK063859            
AK121768            
J013037M21          
J023009A11          
J023010P14          
J033092B03          
J065009O06          
J065053F16          
J065056D18          
J065056N12          
J065075M21          
J065087D19          
J065111N01          
J065172M05          
J065176E03          
J065184D08          
J065188K21          
J065194I05          
J065196E09          
J065196O21          
J065204O06          
J065212J02          
J075066H03          
J075067C04          
J075070I09          
J075081J03          
J075086I05          
J075092E09          
J075096D13          
J075098A12          
J075110B18          
J075116E14          
J075117J23          
J075117O16          
J075130H10          
J075151B07          
J075156C02          
J075159C07          
J075172O12          
J075181K16          
J075185J05          
J075186D14          
J075187F23          
J075194P20          
J090002B21          
J090018E03          
J090029I04          
J090065F12          
J090066M05          
J090078A20          
J090084O15          
J090088P20          
J090098L20          
J100025B19          
J100038H15          
J100045H17          
J100058E17          
J100060O16          
J100067I10          
J100082N24          
J100083C17          
J100085I24          
J100087K20          
TSS from cDNA
TSS information
J075193B15                       5'->3' (+)
Promoter sequence





 
                    
Os02g0785750        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075193B15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+34246205-96
TSS clone peakGclone+34246255-46

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCCCTC+3424621434246223-87-78
Y PatchTCTCTCTCC+3424626534246273-36-28
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGATGGGCTTT+3424603134246042-270-259
 OsREG534TGGATGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG608 GGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG466  GATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG429   ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421    TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCACT+3424605134246060-250-241
 OsREG660TTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478  GGCCCACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.