version
PlantPromoterDB promoter information of J075194L24

Summary of Gene (J075194L24)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0696400        NCBI 
Gene model J075194L24  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 30009213-30010412)

Genome position     
from initiation codon
011-019-C01         
011-027-D04         
013-051-H10         
013-054-A06         
013-061-D06         
013-088-F04         
014-018-C07         
014-026-E10         
AK058291            
AK066125            
AK104912            
BT014685            
J013059H08          
J065065L22          
J065084O06          
J075006O13          
J075013J18          
J075018L23          
J075036E14          
J075039K21          
J075075H13          
J075091A14          
J075093I09          
J075136L17          
J075156M24          
J075174J01          
J075179P15          
J075181F02          
J080302J02          
J080304J11          
J080308A15          
J100041B09          
TSS from cDNA
TSS information
J075194L24                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075194L24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+30010108-105
TSS clone peakTclone+30010109-104
TSS cloneAclone+30010118-95

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTATAAATA+3001007430010082-139-131
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCCGCGTCTCTGGCCCCCACAC+3000983630009859-377-354
 OsREG537CCCCCGCG                 PPDB Motif  PLACE Motif 
 OsREG560    CGCGTCTC             PPDB Motif  PLACE Motif 
 OsREG638          TCTGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG613              GCCCCCAC   PPDB Motif  PLACE Motif 
 OsREG535                CCCCACAC PPDB Motif  PLACE Motif 
REGGCGACGCG+3000994330009950-270-263
 OsREG559GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGCGCGACGCG+3000998330009991-230-222
 OsREG556CGCGACGC  PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGCCGTCGGAT+3001001230010020-201-193
 OsREG546CCGTCGGA  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483 CGTCGGAT PPDB MotifCCGAC  PLACE MotifCGACG 
REGCCACCTGTC+3001002230010030-191-183
 OsREG436CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501 CACCTGTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.