version
PlantPromoterDB promoter information of J080004L13

Summary of Gene (J080004L13)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0274700        NCBI 
Gene model J080004L13  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 10079542-10078343)

Genome position     
from initiation codon
006-064-G03         
006-071-B05         
006-089-D01         
006-098-H02         
009-070-E05         
009-129-F03         
009-130-F01         
009-140-F07         
009-189-F07         
J013071M01          
J023044F05          
J065078M16          
J080004C05          
J080004E12          
J080006H14          
J080008B07          
J080008G01          
J080008I09          
J080008J10          
J080008O08          
J080009O11          
J080009P22          
J080011F13          
J080013K07          
J080014H24          
J080015A13          
J080015N21          
J080016N04          
J080021F19          
J080021K02          
J080023E20          
J080027M18          
J080030A07          
J080031H14          
J080032B12          
J080036N19          
J080036O03          
J080040D10          
J080040E08          
J080041K04          
J080044N24          
J080046C04          
J080046L07          
J080046M19          
J080048N16          
J080049N15          
J080050G22          
J080052A09          
J080053N04          
J080055K09          
J080057G09          
J080058E22          
J080065E22          
J080068E10          
J080068O13          
J080071B21          
J080071C23          
J080074D12          
J080075F18          
J080075J08          
J080075N24          
J080077E23          
J080079M18          
J080080B19          
J080080H19          
J080084C20          
J080084M05          
J080085O19          
J080086E02          
J080087B17          
J080089H02          
J080090O03          
J080091G07          
J080091H02          
J080092C08          
J080092H03          
J080092L08          
J080094F04          
J080094H13          
J080095B19          
J080096G21          
J080096M14          
J090015E19          
TSS from cDNA
TSS information
J080004L13                       5'->3' (-)
Promoter sequence

 
                    
Os12g0274500        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080004L13

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-10080501-59
TSS clone peakAclone-10080498-56

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGATCCG-1008054610080553-104-111
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 
REGCCACGGCC-1008068510080692-243-250
 OsREG521CCACGGCC PPDB Motif  PLACE Motif 
REGGCCCATCA-1008076610080773-324-331
 OsREG607GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGACCCGCGC-1008077510080782-333-340
 OsREG439ACCCGCGC PPDB Motif  PLACE Motif 
REGCCCATCCA-1008078810080795-346-353
 OsREG534CCCATCCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.