version
PlantPromoterDB promoter information of J080005K14

Summary of Gene (J080005K14)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0558000        NCBI 
Gene model J080005K14  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 28016585-28017784)

Genome position     
from initiation codon
006-040-E09         
006-048-E12         
009-015-B04         
009-191-E02         
009-192-E04         
AK061522            
J033065N07          
J043020E09          
J043039D06          
J043039H12          
J043039K10          
J065002G24          
J065030A10          
J065129B19          
J075147I17          
J080006H23          
J080006P09          
J080008N07          
J080011K20          
J080013C06          
J080016I09          
J080017J06          
J080021K12          
J080022N16          
J080023E02          
J080023E03          
J080023F02          
J080024G13          
J080028F03          
J080032J20          
J080046H02          
J080048M12          
J080056C12          
J080057O18          
J080058K03          
J080058O19          
J080066G09          
J080067A05          
J080069B01          
J080069H13          
J080069N08          
J080074E06          
J080076A20          
J080076A22          
J080076G20          
J080076L04          
J080079O09          
J080082A15          
J080082H01          
J080083A15          
J080088N07          
J080089G10          
J080092O20          
J080095H23          
J080097K23          
J080301M02          
J080303D02          
J080304L11          
J080309M05          
J090021H05          
J090039H11          
J090081J03          
J090083B08          
J090095D17          
J100050D19          
TSS from cDNA
TSS information
J080005K14                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080005K14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+28017368-217

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCTCT+2801736628017373-219-212
Y PatchCCTCTCCTCC+2801737728017386-208-199
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAGCCCATAC+2801720828017218-377-367
 OsREG582GAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606   GCCCATAC PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCCAC+2801722228017232-363-353
 OsREG437ACATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCAAAAGGCCCAGTA+2801725828017278-327-307
 OsREG644TCCGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG592    GCCCAAAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG430          AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG473           AGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454            GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG604             GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGATCCAACGGCT+2801728428017294-301-291
 OsREG481ATCCAACG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG518  CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG469   CAACGGCT PPDB MotifCCAACGG  PLACE Motif 
REGCGCCACGTGGCG+2801730328017314-282-271
 OsREG507 GCCACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448CGCCACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.