version
PlantPromoterDB promoter information of J080007J06

Summary of Gene (J080007J06)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0532300        NCBI 
Gene model J080007J06  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 26627683-26626484)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J080007J06                       5'->3' (-)
Promoter sequence

 
012-047-G11         
J033052A20          
J033107A06          
J090030E21          
J090054C05          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080007J06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-26625307-74
TSS clone peakCclone-26625305-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCC-2662530426625312-71-79
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCCGTCCCACGCG-2662535626625369-123-136
 OsREG623GTCCGTCC       PPDB Motif  PLACE Motif 
 OsREG530      CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCAGTA-2662540626625417-173-184
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454   GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG604    GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGTACGGCCCATAA-2662542126625432-188-199
 OsREG645TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605    GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGC-2662543526625442-202-209
 OsREG594TGTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGCCTGTCAGTTTGTGGGCCCACCT-2662548126625503-248-270
 OsREG551CCTGTCAG                PPDB Motif  PLACE MotifTGAC 
 OsREG453 CTGTCAGT               PPDB Motif  PLACE MotifTGAC 
 OsREG597         TTGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG627          TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640           GTGGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628              GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476               GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGCGACACGTGGC-2662556926625579-336-346
 OsREG452CGACACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG507   CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.