version
PlantPromoterDB promoter information of J080007K21

Summary of Gene (J080007K21)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0137400        NCBI 
Gene model J080007K21  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 2152700-2153899)

Genome position     
from initiation codon
005-008-C11         
016-043-A01         
AK065206            
D12777              
J013002F13          
J013020F23          
J013028P21          
J013029I15          
J013033A10          
J013035H24          
J013037B05          
J013046N12          
J013047G12          
J013051H21          
J013060I15          
J013063J05          
J013066E11          
J013073I19          
J013074N10          
J013088J15          
J013093A04          
J013095N01          
J013098H05          
J013105E07          
J013124J22          
J013124P18          
J013147K14          
J013154J24          
J013154M10          
J013160I06          
J013169P11          
J023020A16          
J023023A14          
J023034F03          
J023038D11          
J023060B04          
J023066M23          
J023099A22          
J023130D23          
J033023C19          
J033037H16          
J033038F21          
J033041G11          
J033045J10          
J033057N20          
J033061P18          
J033068G06          
J033091J06          
J033112H07          
J033121E14          
J033140N08          
J033142N08          
J043012M10          
J043017H17          
J043022N08          
J043027M16          
J053023F19          
J053025M18          
J053035B15          
J053035E01          
J053039L22          
J053055P09          
J053063C06          
J053083N07          
J053095K19          
J080032E22          
J080033F12          
J080049K16          
J080050D19          
J090051I06          
J100024N16          
J100028K09          
J100052J19          
J100070I16          
J100071H21          
J100072I15          
J100074J20          
TSS from cDNA
TSS information
J080007K21                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080007K21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+2153001-699

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCT+21530262153033-674-667
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCACTGACATGTGGGCCCCACCTG+21528252152848-875-852
 OsREG522CCACTGAC                 PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA                PPDB Motif  PLACE MotifTGAC 
 OsREG627         TGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640          GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647           TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641            GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631             GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612              GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG514                CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGCCCACCT+21528592152871-841-829
 OsREG640 GTGGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628GGTGGGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476     GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGCACCTGTC+21529012152908-799-792
 OsREG501CACCTGTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.