version
PlantPromoterDB promoter information of J080015C16

Summary of Gene (J080015C16)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0532300        NCBI 
Gene model J080015C16  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 26626583-26625384)

Genome position     
from initiation codon
J075004C21          
TSS from cDNA
TSS information
J080015C16                       5'->3' (-)
Promoter sequence









 
012-047-G11         
AK101608            
J033052A20          
J033107A06          
J090030E21          
J090054C05          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080015C16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-26625307-74
TSS clone peakCclone-26625305-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCC-2662530426625312-71-79
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCCGTCCCACGCG-2662535626625369-123-136
 OsREG623GTCCGTCC       PPDB Motif  PLACE Motif 
 OsREG530      CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCAGTA-2662540626625417-173-184
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454   GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG604    GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGTACGGCCCATAA-2662542126625432-188-199
 OsREG645TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605    GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGC-2662543526625442-202-209
 OsREG594TGTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGCCTGTCAGTTTGTGGGCCCACCT-2662548126625503-248-270
 OsREG551CCTGTCAG                PPDB Motif  PLACE MotifTGAC 
 OsREG453 CTGTCAGT               PPDB Motif  PLACE MotifTGAC 
 OsREG597         TTGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG627          TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640           GTGGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628              GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476               GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGCGACACGTGGC-2662556926625579-336-346
 OsREG452CGACACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG507   CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+26625677AK101608, AK101608

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTC+2662564326625650AK101608
Y PatchTCCTCCTCCCC+2662568926625699AK101608
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTACTGGGCCGGA+2662540626625417AK101608
 OsREG604TACTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCCGTA+2662542126625432AK101608
 OsREG605TTATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG645    GGGCCGTA PPDB MotifGCCCA  PLACE Motif 
REGGCCCAACA+2662543526625442AK101608
 OsREG594GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGAGGTGGGCCCACAAACTGACAGG+2662548126625503AK101608
 OsREG476AGGTGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCCAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG627     GGCCCACA           PPDB MotifGCCCA  PLACE Motif 
 OsREG597      GCCCACAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG453              ACTGACAG  PPDB Motif  PLACE MotifTGAC 
 OsREG551               CTGACAGG PPDB Motif  PLACE MotifTGAC 
REGGCCACGTGTCG+2662556926625579AK101608
 OsREG507GCCACGTG    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509  CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG452   ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.