version
PlantPromoterDB promoter information of J080015E01

Summary of Gene (J080015E01)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0741100        NCBI 
Gene model J080015E01  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 31881082-31882281)

Genome position     
from initiation codon
AK068712            
AK071144            
J065056A02          
J065212F10          
J080005J10          
J080013A11          
J080022G23          
J080025C13          
J080026P14          
J080027D22          
J080027G13          
J080027L23          
J080027N23          
J080028F21          
J080028J18          
J080028P22          
J080038P04          
J080042M11          
J080043B19          
J080045J23          
J080047B06          
J080052F04          
J080057F01          
J080057G03          
J080060H12          
J080061L12          
J080062J17          
J080062M22          
J080072C01          
J080075F01          
J080076A09          
J080076I01          
J080077D01          
J080077F19          
J080079L19          
J080088B03          
J080090J15          
J080092J21          
J080095J12          
J090012C05          
J090039K19          
J090078L12          
TSS from cDNA
TSS information
J080015E01                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080015E01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+31881235-847
TSS clone peakGclone+31881308-774

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCTCTCCTCCTC+3188120431881218-878-864
Y PatchCCTTCTCCTCCCCC+3188122031881233-862-849
Y PatchCCTCTCTC+3188124531881252-837-830
Y PatchCTCCTCCCTC+3188126331881272-819-810
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCCACC+3188097531880982-1107-1100
 OsREG612GCCCCACC PPDB Motif  PLACE Motif 
REGTGTGGGCCAC+3188098631880995-1096-1087
 OsREG627TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654 GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653  TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGCACCGCAC+3188110431881111-978-971
 OsREG500CACCGCAC PPDB Motif  PLACE Motif 
REGGGTGGGGCCCACA+3188115731881169-925-913
 OsREG612GGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627     GGCCCACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.