version
PlantPromoterDB promoter information of J080020A01

Summary of Gene (J080020A01)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0361900        NCBI 
Gene model J080020A01  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 17288176-17286977)

Genome position     
from initiation codon
006-033-D04         
006-034-G10         
AK060107            
AK065490            
AK072091            
AK104602            
AK104747            
J013023H18          
J013105J21          
J033133L03          
J080001O06          
J080004F05          
J080005D12          
J080008G19          
J080015D10          
J080015H22          
J080016K15          
J080018D12          
J080027A09          
J080032F05          
J080039D09          
J080043J19          
J080052G22          
J080052M15          
J080053D22          
J080061I18          
J080064O14          
J080075K01          
J080082I02          
J080095C14          
J100028N14          
TSS from cDNA
TSS information
J080020A01                       5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080020A01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-17287428-252
TSS cloneTclone-17287427-251
TSS clone peakAclone-17287425-249
TSS cloneAclone-17287403-227

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCCT-1728740417287411-228-235
Y PatchCTTCCTCT-1728741317287420-237-244
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACTGACAGGTGGGCCCAGCCC-1728748517287505-309-329
 OsREG453ACTGACAG              PPDB Motif  PLACE MotifTGAC 
 OsREG551 CTGACAGG             PPDB Motif  PLACE MotifTGAC 
 OsREG501   GACAGGTG           PPDB Motif  PLACE Motif 
 OsREG436    ACAGGTGG          PPDB Motif  PLACE Motif 
 OsREG514     CAGGTGGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG476      AGGTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG628       GGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640        GTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG579          GGGCCCAG    PPDB MotifGCCCA  PLACE Motif 
 OsREG620           GGCCCAGC   PPDB MotifGCCCA  PLACE Motif 
 OsREG603            GCCCAGCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG533             CCCAGCCC PPDB MotifGCCCA  PLACE Motif 
REGCTCGGCCCGGT-1728751217287522-336-346
 OsREG575CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG568 TCGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG441   GGCCCGGT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.