version
PlantPromoterDB promoter information of J080029K21

Summary of Gene (J080029K21)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0328000        NCBI 
Gene model J080029K21  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 15224440-15223241)

Genome position     
from initiation codon
AK107977            
J065005I02          
J065049M05          
J080005F01          
J080005H15          
J080005K23          
J080007O03          
J080013H09          
J080024C02          
J080026M22          
J080032K04          
J080034M16          
J080037G11          
J080040L01          
J080041D13          
J080043G20          
J080046H17          
J080048A05          
J080064C21          
J080067E15          
J080071P05          
J080074H16          
J080076A18          
J080076D20          
J080077J15          
J080085J11          
J080086E08          
J080088I23          
J080088I24          
J080089D05          
J080093B04          
J080093D07          
J080094A09          
J080096I12          
J080097L23          
TSS from cDNA
TSS information
J080029K21                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080029K21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-15223572-132

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCCT-1522354315223550-103-110
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGATCGGACGGCC-1522362315223634-183-194
 OsREG589GATCGGAC     PPDB Motif  PLACE Motif 
 OsREG484 ATCGGACG    PPDB Motif  PLACE Motif 
 OsREG545  TCGGACGG   PPDB Motif  PLACE Motif 
 OsREG562   CGGACGGC  PPDB Motif  PLACE Motif 
 OsREG624    GGACGGCC PPDB Motif  PLACE Motif 
REGGGCCGTCCGATC-1522364615223657-206-217
 OsREG624GGCCGTCC     PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545  CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484   CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589    GTCCGATC PPDB Motif  PLACE Motif 
REGTCTGGCCCGTTCGGCCCG-1522367015223687-230-247
 OsREG638TCTGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG424   GGCCCGTT        PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG642         TTCGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG568          TCGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGTTTCGGCCCGGA-1522371315223724-273-284
 OsREG634TTTCGGCC     PPDB Motif  PLACE Motif 
 OsREG642 TTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG568  TCGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544   CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG633    GGCCCGGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.