version
PlantPromoterDB promoter information of J080032B10

Summary of Gene (J080032B10)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0188700        NCBI 
Gene model J080032B10  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 4460863-4459664)

Genome position     
from initiation codon
005-011-B12         
006-065-G03         
006-085-A08         
006-103-A05         
006-103-H09         
009-156-H08         
009-158-A03         
AJ005841            
AK061678            
J065036L19          
J065070F04          
J065082A20          
J065088K18          
J065090J21          
J065152O15          
J065175N18          
J065217M05          
J075025O15          
J075055G13          
J075099F01          
J075102M01          
J075122C01          
J075127M13          
J075148P15          
J075182G19          
J075185N19          
J075195E16          
J080001I12          
J080001N15          
J080003E01          
J080005L24          
J080008B17          
J080008L13          
J080011M03          
J080012E12          
J080014N04          
J080014N16          
J080015K02          
J080022N08          
J080028B14          
J080028P05          
J080031B13          
J080034F05          
J080034H02          
J080036D23          
J080039D04          
J080041B09          
J080043J21          
J080044M16          
J080045L05          
J080047B16          
J080050P20          
J080052G21          
J080054C21          
J080054E05          
J080054P09          
J080061F01          
J080061O22          
J080063P19          
J080064D03          
J080066K22          
J080068J07          
J080068N24          
J080069G17          
J080072D03          
J080072H18          
J080076N01          
J080078N04          
J080080D16          
J080080P08          
J080083K02          
J080086E05          
J080086P10          
J080095G02          
J080097G11          
J080097H16          
J080303M11          
J080304C19          
J080304E11          
J080306N11          
J080308G14          
J080313I18          
J080315E23          
J080316D18          
J080319M07          
J080319O18          
J090006J15          
J090024O07          
J090095K21          
J100031C19          
J100060L05          
J100060O12          
J100063O11          
J100070B22          
J100077D15          
J100090B05          
TSS from cDNA
TSS information
J080032B10                       5'->3' (-)
Promoter sequence

 
J065116B16          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080032B10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-4461792-179

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCCTCTT-44617704461782-157-169
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGGCC-44619334461940-320-327
 OsREG441ACCGGGCC PPDB Motif  PLACE Motif 
REGGCCCAATT-44620714462078-458-465
 OsREG433GCCCAATT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.