version
PlantPromoterDB promoter information of J080036D23

Summary of Gene (J080036D23)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0188700        NCBI 
Gene model J080036D23  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 4462613-4461414)

Genome position     
from initiation codon
005-011-B12         
006-024-G04         
006-065-G03         
006-085-A08         
006-103-A05         
006-103-H09         
009-070-G10         
009-156-H08         
009-158-A03         
009-163-B11         
AJ005841            
AK061678            
AK120500            
J013040H19          
J013041B20          
J013122B18          
J013128C16          
J023126A11          
J023149O08          
J033113L02          
J065026F18          
J065027A10          
J065029H04          
J065036L19          
J065053G22          
J065060P10          
J065063G08          
J065070F04          
J065071J12          
J065082A20          
J065088K18          
J065090J21          
J065110I15          
J065142N11          
J065152O15          
J065175N18          
J065181H15          
J065217M05          
J075005B13          
J075010A01          
J075025N08          
J075025O15          
J075026N03          
J075029K03          
J075046J23          
J075048H19          
J075055G13          
J075057N05          
J075074K15          
J075078O08          
J075083L08          
J075085A13          
J075090M08          
J075099F01          
J075102M01          
J075122C01          
J075127M13          
J075130F22          
J075148P15          
J075154P15          
J075164F18          
J075169C02          
J075182G19          
J075185N19          
J075191F06          
J075195E16          
J080001I12          
J080001N15          
J080003E01          
J080003F14          
J080005L24          
J080008B17          
J080008L13          
J080011M03          
J080012E12          
J080014N04          
J080014N16          
J080015K01          
J080015K02          
J080022N08          
J080028B14          
J080028P05          
J080030O11          
J080031B13          
J080032B10          
J080032L01          
J080034F05          
J080034H02          
J080034L14          
J080036E01          
J080039D04          
J080039E23          
J080041B09          
J080043J21          
J080043N22          
J080044M16          
J080045L05          
J080046F10          
J080046N09          
J080047B16          
J080050P20          
J080052G21          
J080054C21          
J080054E05          
J080054P09          
J080061F01          
J080061O22          
J080063B22          
J080063F13          
J080063P19          
J080064D03          
J080066K22          
J080068J07          
J080068N24          
J080069G17          
J080072D03          
J080072H18          
J080076N01          
J080078N04          
J080080D16          
J080080P08          
J080083K02          
J080086E05          
J080086P10          
J080091G21          
J080091K23          
J080095G02          
J080096L19          
J080097G11          
J080097H16          
J080303H17          
J080303M11          
J080304C19          
J080304E11          
J080306N11          
J080307N23          
J080308G14          
J080309F13          
J080313I18          
J080315E23          
J080316D18          
J080319M07          
J080319O18          
J090006J15          
J090024O07          
J090095K21          
J100031C19          
J100040B18          
J100042M17          
J100060L05          
J100060O12          
J100063O11          
J100070B22          
J100077D15          
J100090B05          
TSS from cDNA
TSS information
J080036D23                       5'->3' (-)
Promoter sequence






 
J065116B16          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080036D23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-4461792-179

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCCTCTT-44617704461782-157-169
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGGCC-44619334461940-320-327
 OsREG441ACCGGGCC PPDB Motif  PLACE Motif 
REGGCCCAATT-44620714462078-458-465
 OsREG433GCCCAATT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.