version
PlantPromoterDB promoter information of J080039B11

Summary of Gene (J080039B11)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0220600        NCBI 
Gene model J080039B11  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 6749582-6750781)

Genome position     
from initiation codon
009-091-E01         
J033100M18          
TSS from cDNA
TSS information
J080039B11                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080039B11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+6750988-244

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAGGCCCGTT+67507976750807-435-425
 OsREG497CAAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG424   GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGATCCAACGG+67508116750819-421-413
 OsREG481ATCCAACG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG PPDB MotifCCAACGG  PLACE Motif 
REGGGGCCAGA+67508336750840-399-392
 OsREG638GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGCCGTCCGATC+67508866750896-346-336
 OsREG562GCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545 CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484  CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589   GTCCGATC PPDB Motif  PLACE Motif 
REGATCGGACGGCCGAGAT+67509146750929-318-303
 OsREG484ATCGGACG         PPDB Motif  PLACE Motif 
 OsREG545 TCGGACGG        PPDB Motif  PLACE Motif 
 OsREG562  CGGACGGC       PPDB Motif  PLACE Motif 
 OsREG624   GGACGGCC      PPDB Motif  PLACE Motif 
 OsREG635       GGCCGAGA  PPDB Motif  PLACE Motif 
 OsREG485        GCCGAGAT PPDB Motif  PLACE Motif 
REGACCCGCGC+67509316750938-301-294
 OsREG439ACCCGCGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.