version
PlantPromoterDB promoter information of J080039J04

Summary of Gene (J080039J04)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0128500        NCBI 
Gene model J080039J04  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 1510956-1512155)

Genome position     
from initiation codon
AK058563            
AK122132            
J033133F04          
J065094M24          
J065122J07          
J065137G10          
J065178L09          
J080011E11          
J080020G21          
J080039H03          
TSS from cDNA
TSS information
J080039J04                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080039J04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+1511827-129
TSS clone peakGclone+1511832-124

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCCTCCC+15118411511852-115-104
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGCCCAGTT+15115581511568-398-388
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG428 AAGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG425   GCCCAGTT PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCCTGA+15117091511720-247-236
 OsREG493ATTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG646    GGGCCTGA PPDB MotifGCCCA  PLACE Motif 
REGGACAGGTGGGCCCG+15117401511753-216-203
 OsREG501GACAGGTG       PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG      PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG476   AGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG566      TGGGCCCG PPDB MotifGCCCA, ACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.