version
PlantPromoterDB promoter information of J080039N12

Summary of Gene (J080039N12)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0594900        NCBI 
Gene model J080039N12  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 24970382-24969183)

Genome position     
from initiation codon
AK070921            
J023074J04          
J023078B04          
J023078N11          
J075143E19          
J075187L10          
J080010N23          
J080013C01          
J080013G03          
J080016I23          
J080017E01          
J080029E18          
J080034L24          
J080067L11          
J080068N08          
J080069E19          
J080071E16          
J080077J09          
J080085E03          
TSS from cDNA
TSS information
J080039N12                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080039N12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-24969427-45

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGGCTATATATACCGC-2496945124969466-69-84
Y PatchCTCTCCTC-2496944224969449-60-67
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTCGCGCGC-2496953724969545-155-163
 OsREG558CTCGCGCG  PPDB MotifACGCGC  PLACE Motif 
 OsREG617 TCGCGCGC PPDB Motif  PLACE Motif 
REGGCCCACGC-2496954724969554-165-172
 OsREG602GCCCACGC PPDB MotifGCCCA  PLACE Motif 
REGCGCGCGACGCCGCGACGCG-2496967824969696-296-314
 OsREG557CGCGCGAC            PPDB MotifACGCGC  PLACE Motif 
 OsREG556  CGCGACGCCGCGACGC  PPDB Motif  PLACE MotifCGACG 
 OsREG559           GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGCGCACGCG-2496970824969715-326-333
 OsREG555CGCACGCG PPDB Motif  PLACE Motif 
REGCGCGCGAG-2496971924969726-337-344
 OsREG558CGCGCGAG PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.