version
PlantPromoterDB promoter information of J080041L21

Summary of Gene (J080041L21)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0180900        NCBI 
Gene model J080041L21  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 4297762-4298961)

Genome position     
from initiation codon
011-035-H08         
AK060711            
J033132M11          
J065081C24          
J090008I06          
J100060M07          
J100074C10          
J100088L17          
TSS from cDNA
TSS information
J080041L21                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080041L21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+4295324-938
TSS clone peakAclone+4295325-937

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCACCTATATAAC+42952894295300-973-962
Y PatchCCTCTCTCCC+42953004295309-962-953
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATATGGGCCAA+42951064295116-1156-1146
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGAACTGGGC+42951404295147-1122-1115
 OsREG425AACTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGACGGCCCATCT+42951624295173-1100-1089
 OsREG584GACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456    GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCAGCCCA+42951844295197-1078-1065
 OsREG497CAAGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG473  AGGCCCAG     PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GCCCAGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG533     CCCAGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG523      CCAGCCCA PPDB MotifGCCCA  PLACE Motif 
REGTCCACGCC+42952144295221-1048-1041
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 
REGGGTCCAGA+42952394295246-1023-1016
 OsREG649GGTCCAGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACAGCCCAAAT+42988184298828AK066918, AK070512
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGCACGTGGCCCCACTCC+42989204298935AK066918, AK070512
 OsREG507CACGTGGC         PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG631     GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG532        CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTCACC+42989404298950AK066918, AK070512
 OsREG585GCCACGTC    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505  CACGTCAC  PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447   ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.