version
PlantPromoterDB promoter information of J080043L04

Summary of Gene (J080043L04)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0606200        NCBI 
Gene model J080043L04  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 23499877-23501076)

Genome position     
from initiation codon
009-030-E09         
009-076-H10         
009-122-H12         
009-153-F09         
AB055076            
AK072384            
AK107928            
J023078E13          
J053031N01          
J053046K19          
J053062P07          
J053091C23          
J053099N19          
J065005E06          
J065030N03          
J065138O21          
J065159K03          
J075030M08          
J080006E23          
J080010D10          
J080016N17          
J080024N09          
J080028E23          
J080035I11          
J080038D15          
J080040H08          
J080047C06          
J080061G04          
J080066E10          
J080067P03          
J080082D07          
J080089M13          
J080094O09          
J080095C24          
J080309E21          
J090016G15          
J090031C20          
J090033A15          
J090037L07          
J090038I10          
J090072P19          
J100040J02          
J100047N05          
J100048M10          
J100076C02          
J100077G23          
J100080O08          
J100085C06          
J100085F16          
TSS from cDNA
TSS information
J080043L04                       5'->3' (+)
Promoter sequence








 
Os03g0606100        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080043L04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+23500772-105
TSS clone peakTclone+23500789-88

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCCC+2350077923500786-98-91
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACACGTGG+2350059323500601-284-276
 OsREG509GACACGTG  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 ACACGTGG PPDB MotifACGT  PLACE Motif 
REGAAAAGCCC+2350061923500626-258-251
 OsREG419AAAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCATGT+2350064823500659-229-218
 OsREG538CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517   GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437    GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGCCAGGCCCACT+2350066823500678-209-199
 OsREG524CCAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG472  AGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478   GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGTCTGGCCCACGTG+2350068323500695-194-182
 OsREG638TCTGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG577 CTGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG654  TGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG449    GCCCACGT  PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508     CCCACGTG PPDB MotifACGT  PLACE Motif 
REGGAGGCCCATCT+2350070623500716-171-161
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.