version
PlantPromoterDB promoter information of J080044C19

Summary of Gene (J080044C19)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0807200        NCBI 
Gene model J080044C19  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 34592015-34590816)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J080044C19                       5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080044C19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-34590192-827

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCC-3459015034590157-785-792
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTTTGGGCCGGGCCGTC-3459024734590263-882-898
 OsREG593GTTTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544       CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG446        CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG584         GGGCCGTC PPDB MotifGCCCA  PLACE Motif 
REGCGGGCCGTG-3459026834590276-903-911
 OsREG446CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG504 GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGGGCCGGC-3459029534590307-930-942
 OsREG538GGGCCGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG614 GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616  GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544   CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG615     GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGGC-3459031234590319-947-954
 OsREG616GGCCCGGC PPDB Motif  PLACE Motif 
REGGAAGCCCAAG-3459032334590332-958-967
 OsREG582GAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG459  AGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCAGC-3459034434590354-979-989
 OsREG538CCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.