version
PlantPromoterDB promoter information of J080044N10

Summary of Gene (J080044N10)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0116100        NCBI 
Gene model J080044N10  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 859403-858204)

Genome position     
from initiation codon
006-049-G01         
006-064-F09         
006-066-C04         
006-082-A03         
006-092-G06         
006-102-F09         
AB037970            
AK061836            
AK070895            
AY074786            
J013022K21          
J013154A03          
J023074C02          
J023091I19          
J023135M05          
J043020L13          
J065027L11          
J065065A08          
J065120A08          
J065174A05          
J065184O22          
J065191D07          
J065209D04          
J075014F11          
J075036D03          
J075157D23          
J080007F15          
J080008N12          
J080010F22          
J080011C19          
J080011F12          
J080012E11          
J080015B12          
J080015O16          
J080016G24          
J080016K13          
J080018A02          
J080018H03          
J080022M01          
J080023D20          
J080023I01          
J080023J05          
J080024A09          
J080024I09          
J080025A10          
J080025G04          
J080027D21          
J080029M05          
J080030J01          
J080034D10          
J080036F18          
J080038N11          
J080039B07          
J080039E01          
J080039K11          
J080040B09          
J080040G11          
J080041H08          
J080041H19          
J080041O20          
J080042C15          
J080043C16          
J080043F18          
J080044B17          
J080044O07          
J080045H15          
J080045I03          
J080046A05          
J080048I06          
J080049L04          
J080049M09          
J080050G11          
J080051G20          
J080053C09          
J080053I05          
J080053P18          
J080054K10          
J080054P14          
J080057L05          
J080062K11          
J080063C19          
J080065B03          
J080066E15          
J080066H05          
J080066I05          
J080068O11          
J080070L22          
J080071I12          
J080071N20          
J080072D10          
J080072I10          
J080074G03          
J080076E23          
J080076N03          
J080077N23          
J080084B13          
J080084F07          
J080085J15          
J080085P20          
J080090F21          
J080093H16          
J080093J01          
J080093L04          
J080097E24          
J090012G04          
J090054K05          
TSS from cDNA
TSS information
J080044N10                       5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080044N10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-858487-84
TSS clone peakGclone-858482-79

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCCCTATAAATC-858511858522-108-119
Y PatchCCTCCCCC-858500858507-97-104
Y PatchTCCCCCTCCC-858519858528-116-125
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCTGGGCCCCACA-858561858573-158-170
 OsREG550CCTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611     GCCCCACA PPDB Motif  PLACE Motif 
REGTTGGCCCATGGGCCGCCACGTC-858641858662-238-259
 OsREG660TTGGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT              PPDB MotifGCCCA  PLACE Motif 
 OsREG525   GCCCATGGGC          PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517  GGCCCATGGGCC         PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490       ATGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG618        TGGGCCGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG448             CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585              GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGAACGGGCC-858769858776-366-373
 OsREG424AACGGGCC PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.