version
PlantPromoterDB promoter information of J080046C04

Summary of Gene (J080046C04)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0274700        NCBI 
Gene model J080046C04  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 10081442-10080243)

Genome position     
from initiation codon
003-008-G09         
006-028-B09         
006-029-D12         
006-034-G05         
006-036-A02         
006-039-A08         
006-057-H10         
006-064-D08         
006-064-G03         
006-071-B05         
006-089-D01         
006-095-G02         
006-098-H02         
006-109-H01         
006-115-H09         
006-120-B02         
009-005-E08         
009-027-E04         
009-028-A10         
009-050-G03         
009-070-E05         
009-095-D10         
009-103-A05         
009-113-G09         
009-116-E08         
009-125-F02         
009-125-F09         
009-129-F03         
009-130-F01         
009-140-F07         
009-151-F07         
009-153-D04         
009-165-D08         
009-170-E11         
009-171-C01         
009-171-G05         
009-189-F07         
009-193-H05         
009-194-D08         
AF017364            
AF052305            
AK061611            
AK119219            
AK121444            
D00643              
J013031F15          
J013037P20          
J013050D13          
J013056J24          
J013071M01          
J013074G12          
J013120E19          
J013124M17          
J013127I18          
J013129G13          
J013132L16          
J013146M05          
J023044F05          
J023056E16          
J023141B14          
J065008E12          
J065010I24          
J065013B01          
J065019L16          
J065021E19          
J065027G11          
J065039K03          
J065044I07          
J065047B10          
J065050A16          
J065050B15          
J065052H09          
J065053K05          
J065061H12          
J065061M13          
J065078M16          
J065083L13          
J065084L01          
J065091O21          
J065095D06          
J065095J12          
J065097I18          
J065114N19          
J065118P09          
J065123F08          
J065124B04          
J065128C04          
J065137J07          
J065165K23          
J065183D22          
J065195B17          
J065201N18          
J065204K15          
J065208F08          
J075011P21          
J075020D18          
J075028H08          
J075065H14          
J075069O11          
J075071P10          
J075177C11          
J080002E12          
J080002F23          
J080002J09          
J080003L11          
J080004C05          
J080004E12          
J080004L13          
J080006E06          
J080006H14          
J080008B07          
J080008C21          
J080008G01          
J080008I09          
J080008J10          
J080008O08          
J080009C10          
J080009M22          
J080009O11          
J080009P22          
J080010B11          
J080010K04          
J080011F13          
J080013K07          
J080014H24          
J080015A13          
J080015G11          
J080015N21          
J080016N04          
J080018I15          
J080018O22          
J080020N07          
J080021F19          
J080021K02          
J080023E20          
J080025M08          
J080026E10          
J080027M18          
J080029C04          
J080030A07          
J080030A13          
J080030D14          
J080030D18          
J080031H14          
J080031N07          
J080032B12          
J080036N19          
J080036O03          
J080038J23          
J080040D10          
J080040E08          
J080041K04          
J080042F24          
J080042H22          
J080042H23          
J080044N24          
J080045F16          
J080046C19          
J080046L07          
J080046M19          
J080048N16          
J080048P05          
J080049N15          
J080050G22          
J080052A09          
J080052J01          
J080053N04          
J080055K09          
J080056N06          
J080057G09          
J080058E22          
J080059E04          
J080061F19          
J080062C19          
J080062E15          
J080063M12          
J080063P12          
J080064F02          
J080064O16          
J080065E22          
J080066C18          
J080068E10          
J080068O13          
J080069A09          
J080069M24          
J080071B21          
J080071C23          
J080072H01          
J080072I16          
J080074D12          
J080075F18          
J080075J08          
J080075N24          
J080076L02          
J080076L21          
J080077E23          
J080079M18          
J080080B19          
J080080H19          
J080080L11          
J080081L18          
J080082N16          
J080083M19          
J080084C20          
J080084M05          
J080085O19          
J080086E02          
J080087B17          
J080088G21          
J080088M20          
J080089H02          
J080090F01          
J080090O03          
J080091F10          
J080091F21          
J080091G07          
J080091H02          
J080092C01          
J080092C08          
J080092H03          
J080092L08          
J080094F04          
J080094H13          
J080095B19          
J080096G21          
J080096M14          
J080097M21          
J080308I23          
J080319A21          
J090009G07          
J090015E19          
L22155              
TSS from cDNA
TSS information
J080046C04                       5'->3' (-)
Promoter sequence


 
                    
Os12g0275000        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080046C04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-10080501-59
TSS clone peakAclone-10080498-56

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGATCCG-1008054610080553-104-111
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 
REGCCACGGCC-1008068510080692-243-250
 OsREG521CCACGGCC PPDB Motif  PLACE Motif 
REGGCCCATCA-1008076610080773-324-331
 OsREG607GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGACCCGCGC-1008077510080782-333-340
 OsREG439ACCCGCGC PPDB Motif  PLACE Motif 
REGCCCATCCA-1008078810080795-346-353
 OsREG534CCCATCCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.