version
PlantPromoterDB promoter information of J080049C17

Summary of Gene (J080049C17)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0591800        NCBI 
Gene model J080049C17  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 23746909-23745710)

Genome position     
from initiation codon
AK060611            
AK102534            
J033096G24          
J075057H08          
J075179P18          
J080010P06          
J080011H01          
J080013E16          
J080013J16          
J080018E14          
J080018L06          
J080018M24          
J080026N17          
J080037A15          
J080047A13          
J080050G07          
J080064D10          
J080077E03          
J080080A03          
J080080G20          
J080080I03          
J080081H12          
J080089B08          
J080090K07          
J080092O06          
J080096B07          
J080097M08          
J080097P13          
TSS from cDNA
TSS information
J080049C17                       5'->3' (-)
Promoter sequence









 
J080002M01          
J080009G19          
J080020J18          
J080023G03          
J080025D13          
J080041M15          
J080042A05          
J080042E05          
J080046G14          
J080046J23          
J080048L21          
J080050D11          
J080050O16          
J080052C12          
J080052L18          
J080054N10          
J080056J24          
J080058M10          
J080060L03          
J080064G09          
J080072D15          
J080076N10          
J080078A06          
J080081F02          
J080083P10          
J080084F24          
J080087L02          
J080088L09          
J080089H18          
J080096K22          
J080096N01          
J080097L05          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080049C17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-23745960-51

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATACAC-2374598223745989-73-80
Y PatchTCTTCCTC-2374596623745973-57-64
Y PatchCCTCCTCC-2374599723746004-88-95
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACATGGGCTAGGCCCACT-2374603923746056-130-147
 OsREG437ACATGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT          PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG656        TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG472         AGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478          GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCATAA-2374606723746077-158-168
 OsREG658TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605   GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCGCA-2374608323746093-174-184
 OsREG627TGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564 GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618  TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643   GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAGCC-2374610023746108-191-199
 OsREG464AGCCCAGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG603 GCCCAGCC PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCGTGGTGGCCCATT-2374612523746146-216-237
 OsREG480ATATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT            PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG           PPDB MotifGCCCA  PLACE Motif 
 OsREG521     GGCCGTGG          PPDB Motif  PLACE Motif 
 OsREG653            GTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG488             TGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG431              GGCCCATT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.