PlantPromoterDB promoter information of J080050G11
Summary of Gene (J080050G11)
|
Overview
|
Focused view (chromosome 5: 860153-858954)
|
Genome position
from initiation codon TSS from cDNA TSS information J080050G11 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence |
|
|
|
Promoter Summary of J080050G11
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | A | clone | - | 858487 | -84 |
| TSS clone peak | G | clone | - | 858482 | -79 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | TCCCTATAAATC | - | 858511 | 858522 | -108 | -119 |
| Y Patch | CCTCCCCC | - | 858500 | 858507 | -97 | -104 |
| Y Patch | TCCCCCTCCC | - | 858519 | 858528 | -116 | -125 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CCTGGGCCCCACA | - | 858561 | 858573 | -158 | -170 | |||
| OsREG550 | CCTGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG579 | CTGGGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG647 | TGGGCCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG641 | GGGCCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG631 | GGCCCCAC | PPDB Motif | PLACE Motif | ||||||
| OsREG611 | GCCCCACA | PPDB Motif | PLACE Motif | ||||||
| REG | TTGGCCCATGGGCCGCCACGTC | - | 858641 | 858662 | -238 | -259 | |||
| OsREG660 | TTGGCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG488 | TGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG525 | GCCCATGGGC | PPDB Motif | GCCCA, CCATGG | PLACE Motif | |||||
| OsREG517 | GGCCCATGGGCC | PPDB Motif | GCCCA, CCATGG | PLACE Motif | |||||
| OsREG490 | ATGGGCCG | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG618 | TGGGCCGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG448 | CGCCACGT | PPDB Motif | ACGT | PLACE Motif | ACGTGKC | ||||
| OsREG585 | GCCACGTC | PPDB Motif | ACGT | PLACE Motif | ACGTGKC | ||||
| REG | AACGGGCC | - | 858769 | 858776 | -366 | -373 | |||
| OsREG424 | AACGGGCC | PPDB Motif | AAACG(C/G), ACGGGC, CCAACGG | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||