version
PlantPromoterDB promoter information of J080050H10

Summary of Gene (J080050H10)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0618800        NCBI 
Gene model J080050H10  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 26199771-26200970)

Genome position     
from initiation codon
009-116-H12         
AK074019            
J033074L14          
J065187P13          
J080002E06          
J080010A10          
J080012N16          
J080014F21          
J080016E05          
J080018L10          
J080021F24          
J080022M11          
J080023F12          
J080023H02          
J080024A13          
J080025F03          
J080025F04          
J080028H05          
J080030B18          
J080031E07          
J080033H12          
J080038J06          
J080039M20          
J080042E01          
J080042G10          
J080044H14          
J080046F19          
J080047A01          
J080049O03          
J080052P06          
J080052P09          
J080056I06          
J080061A12          
J080061I04          
J080063K06          
J080069I24          
J080072D24          
J080076D19          
J080076F15          
J080076I22          
J080076J11          
J080077C19          
J080080A22          
J080081E12          
J080081I23          
J080084H01          
J080085A04          
J080085N21          
J080086A14          
J080086G22          
J080096H06          
J080097G06          
J090002O14          
J100072G23          
J100077M11          
TSS from cDNA
TSS information
J080050H10                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080050H10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+26200649-122

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCT+2620062326200630-148-141
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCGGCCCGGCCGGCCCATCCCGGCCCAGCC+2620053626200566-235-205
 OsREG644TCCGGCCC                        PPDB MotifGCCCA  PLACE Motif 
 OsREG544  CGGCCCGG                      PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC                     PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC                    PPDB Motif  PLACE Motif 
 OsREG615         GCCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG542          CCGGCCCA  CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490           CGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG590            GGCCCATC            PPDB MotifGCCCA  PLACE Motif 
 OsREG608             GCCCATCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG538                   CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG565                     CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG620                      GGCCCAGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG603                       GCCCAGCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.