version
PlantPromoterDB promoter information of J080050K14

Summary of Gene (J080050K14)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0158300        NCBI 
Gene model J080050K14  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 3156933-3155734)

Genome position     
from initiation codon
006-049-G04         
AK067376            
AK099188            
AK104773            
J013106F16          
J013123H22          
J023029J02          
J023029J03          
J033138N08          
J075011F05          
J075022F10          
J075071L13          
J075094B08          
J075119B21          
J075140L02          
J075199O21          
J080001I17          
J080005M04          
J080011P17          
J080026B14          
J080026C12          
J080030N16          
J080035K23          
J080039J22          
J080045D04          
J080050C06          
J080051I09          
J080053F18          
J080053G10          
J080055F05          
J080057E22          
J080058F17          
J080063C18          
J080065E02          
J080066E06          
J080067O05          
J080068N15          
J080071O04          
J080074A20          
J080074E14          
J080074L05          
J080075E08          
J080075H07          
J080077D04          
J080077N15          
J080078A07          
J080079H22          
J080080F20          
J080080M22          
J080081K09          
J080081L04          
J080090K09          
J080093O13          
J080094A18          
J080094E10          
J080094H06          
J080096I21          
J100081A19          
TSS from cDNA
TSS information
J080050K14                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080050K14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-3156742-809
TSS clone peakCclone-3156741-808

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCCTCC-31567123156723-779-790
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTACGGCCCATTA-31567963156807-863-874
 OsREG645TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610    GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-31568273156834-894-901
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGTAGGCCCAATT-31569063156916-973-983
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433   GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCCTAATGGGCTCCAGGCCCAACC-31569223156951-989-1018
 OsREG581CTTGGGCC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG639 TTGGGCCC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG475  TGGGCCCT                     PPDB MotifGCCCA  PLACE Motif 
 OsREG610         TAATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG432          AATGGGCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG524                  CCAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG513                   CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471                    AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626                     GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595                      GCCCAACC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.