version
PlantPromoterDB promoter information of J080052D18

Summary of Gene (J080052D18)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0807200        NCBI 
Gene model J080052D18  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 34589515-34588316)

Genome position     
from initiation codon
011-031-F07         
AK063932            
AK103496            
AK122072            
J033117M21          
J033131A04          
J065079B08          
J065109O03          
J065121K05          
J065136D04          
J080001M11          
J080002H18          
J080005I08          
J080006B05          
J080006D17          
J080007M19          
J080011E07          
J080012H06          
J080014D08          
J080017D06          
J080017K17          
J080020B17          
J080021O05          
J080021O15          
J080023I18          
J080025A21          
J080027P22          
J080028M22          
J080029B09          
J080029M07          
J080029M17          
J080030H23          
J080030K16          
J080030L19          
J080031A12          
J080031N21          
J080032G05          
J080032P20          
J080033H20          
J080034H22          
J080034J03          
J080034J16          
J080034N01          
J080035K20          
J080036I04          
J080036I19          
J080036O21          
J080038D06          
J080039J15          
J080039P18          
J080041H20          
J080041M11          
J080042F14          
J080043G10          
J080043J02          
J080044C19          
J080044G11          
J080045M03          
J080045N07          
J080047K14          
J080049I21          
J080050A06          
J080050I16          
J080050N16          
J080052C23          
J080052F20          
J080052F23          
J080053M03          
J080054G13          
J080054H12          
J080055N03          
J080056E07          
J080057L04          
J080063O19          
J080064E21          
J080065D18          
J080065F18          
J080065H14          
J080065K15          
J080065M24          
J080066B18          
J080066B19          
J080071H19          
J080072E18          
J080074K21          
J080075B06          
J080076H07          
J080079D16          
J080082B20          
J080084N16          
J080085L07          
J080086L04          
J080086M07          
J080087D02          
J080087D15          
J080087J19          
J080088G20          
J080092M15          
J080093O10          
J080095L09          
J080096A18          
J080097C03          
J090019J07          
J090024N12          
J090049I09          
TSS from cDNA
TSS information
J080052D18                       5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080052D18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-34590192-827

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCC-3459015034590157-785-792
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTTTGGGCCGGGCCGTC-3459024734590263-882-898
 OsREG593GTTTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544       CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG446        CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG584         GGGCCGTC PPDB MotifGCCCA  PLACE Motif 
REGCGGGCCGTG-3459026834590276-903-911
 OsREG446CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG504 GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGGGCCGGC-3459029534590307-930-942
 OsREG538GGGCCGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG614 GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616  GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544   CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG615     GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGGC-3459031234590319-947-954
 OsREG616GGCCCGGC PPDB Motif  PLACE Motif 
REGGAAGCCCAAG-3459032334590332-958-967
 OsREG582GAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG459  AGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCAGC-3459034434590354-979-989
 OsREG538CCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.