version
PlantPromoterDB promoter information of J080056N01

Summary of Gene (J080056N01)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0767800        NCBI 
Gene model J080056N01  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 32640466-32641665)

Genome position     
from initiation codon
004-017-A08         
006-025-G11         
006-035-H03         
006-068-G10         
006-088-G04         
006-094-C05         
006-101-G10         
006-108-G09         
006-112-E05         
006-116-F01         
009-055-C02         
009-128-G07         
009-181-D09         
AF283006            
AK060000            
AK060906            
AK066036            
J013038D23          
J013049B03          
J013057H16          
J013147M24          
J023026I12          
J023049J16          
J033037M10          
J033057D13          
J033072O12          
J033105H16          
J033119G10          
J065023C15          
J065080D13          
J065173E09          
J080003C23          
J080003P09          
J080004K04          
J080010M14          
J080011J21          
J080013J01          
J080015A16          
J080021F07          
J080023F18          
J080034D18          
J080034O19          
J080035I09          
J080038J08          
J080039N10          
J080042P09          
J080043E10          
J080051M02          
J080051O17          
J080053B01          
J080058J20          
J080061B11          
J080064B15          
J080064O18          
J080065D07          
J080071A15          
J080071C13          
J080071F14          
J080071M21          
J080072A10          
J080075J05          
J080076A05          
J080078F05          
J080078K01          
J080081F11          
J080081K15          
J080084K03          
J080089F18          
J080095A21          
J100022L11          
J100029I01          
J100032I15          
J100062N24          
J100067E13          
J100075G02          
J100080L14          
TSS from cDNA
TSS information
J080056N01                       5'->3' (+)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080056N01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+32641336-130
TSS clone peakGclone+32641363-103

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCACGTGTCC+3264123332641242-233-224
 OsREG434CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509 CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451  ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCCACCTGT+3264129432641302-172-164
 OsREG514CCCACCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG436 CCACCTGT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.