version
PlantPromoterDB promoter information of J080060C19

Summary of Gene (J080060C19)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0410900        NCBI 
Gene model J080060C19  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 17576180-17577379)

Genome position     
from initiation codon
J065067F10          
J065073D08          
J065176C06          
J065189O13          
J065214E05          
J080007H09          
J080012B19          
J080020J16          
J080038J22          
J080045I09          
J080059M16          
J080080P22          
J080083C03          
J080093M17          
J100029F12          
TSS from cDNA
TSS information
J080060C19                       5'->3' (+)
Promoter sequence









 
J065015G22          
J065061O12          
J065102A22          
J065122F22          
J065122P05          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080060C19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+17577110-70

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGTGCG+1757686917576876-311-304
 OsREG555CGCGTGCG PPDB Motif  PLACE Motif 
REGTCATGGGCCGC+1757692817576938-252-242
 OsREG609TCATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC PPDB MotifGCCCA  PLACE Motif 
REGCACGGCCCAGTT+1757694617576957-234-223
 OsREG504CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565  CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454   GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG425    GCCCAGTT PPDB MotifGCCCA  PLACE Motif 
REGCCATGGGCCGC+1757696117576971-219-209
 OsREG525CCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC PPDB MotifGCCCA  PLACE Motif 
REGTCCGACGG+1757697617576983-204-197
 OsREG546TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCGGGCCCAGTT+1757699917577009-181-171
 OsREG566CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG579 GGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454  GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG425   GCCCAGTT PPDB MotifGCCCA  PLACE Motif 
REGTCGTGGGCCGGG+1757701317577024-167-156
 OsREG601TCGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-17576880J065102A22

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCGGCCCATGA-1757692817576938J065102A22
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609   GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGAACTGGGCCGTG-1757694617576957J065102A22
 OsREG425AACTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCATGG-1757696117576971J065102A22
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525   GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGCCGTCGGA-1757697617576983J065102A22
 OsREG546CCGTCGGA PPDB MotifCCGAC  PLACE MotifCGACG 
REGAACTGGGCCCG-1757699917577009J065102A22
 OsREG425AACTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGCCCGGCCCACGA-1757701317577024J065102A22
 OsREG538CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601    GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGCCGAGCCGACGCGTCC-1757708417577099J065102A22
 OsREG540CCGAGCCG         PPDB Motif  PLACE Motif 
 OsREG442        ACGCGTCC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.